Incidental Mutation 'R3774:Dnajc15'
ID273520
Institutional Source Beutler Lab
Gene Symbol Dnajc15
Ensembl Gene ENSMUSG00000022013
Gene NameDnaJ heat shock protein family (Hsp40) member C15
SynonymsDnajd1, 1110003P16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location77820681-77875125 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 77856937 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022590] [ENSMUST00000226459]
Predicted Effect probably benign
Transcript: ENSMUST00000022590
SMART Domains Protein: ENSMUSP00000022590
Gene: ENSMUSG00000022013

DomainStartEndE-ValueType
low complexity region 34 53 N/A INTRINSIC
DnaJ 93 147 6.8e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000226459
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mitochondrial activity that results in rapid metabolism in fasted mice or mice fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Dnajc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02607:Dnajc15 APN 14 77840216 missense probably damaging 1.00
R0321:Dnajc15 UTSW 14 77874833 missense possibly damaging 0.90
R1574:Dnajc15 UTSW 14 77826414 missense probably benign 0.00
R1574:Dnajc15 UTSW 14 77826414 missense probably benign 0.00
R4397:Dnajc15 UTSW 14 77874794 splice site probably null
R4747:Dnajc15 UTSW 14 77844456 missense probably benign 0.13
R5704:Dnajc15 UTSW 14 77826458 missense probably damaging 1.00
R7848:Dnajc15 UTSW 14 77840203 missense probably damaging 0.99
R8179:Dnajc15 UTSW 14 77852953 missense
Predicted Primers PCR Primer
(F):5'- CTGGGCCTCACTTTTGAACTG -3'
(R):5'- TCGTCAGAGCAGCACTTGAAG -3'

Sequencing Primer
(F):5'- TTCAAGCTAGCTGGTCCAAG -3'
(R):5'- GAGCAGCACTTGAAGATAGTTTATTC -3'
Posted On2015-03-25