Incidental Mutation 'R3774:Unkl'
ID273522
Institutional Source Beutler Lab
Gene Symbol Unkl
Ensembl Gene ENSMUSG00000015127
Gene Nameunkempt family like zinc finger
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R3774 (G1)
Quality Score111
Status Not validated
Chromosome17
Chromosomal Location25188397-25234443 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 25188407 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039734] [ENSMUST00000088307] [ENSMUST00000160785] [ENSMUST00000160896]
Predicted Effect probably null
Transcript: ENSMUST00000039734
SMART Domains Protein: ENSMUSP00000039670
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
low complexity region 61 69 N/A INTRINSIC
ZnF_C3H1 76 103 1.33e-1 SMART
Blast:ZnF_C3H1 115 144 7e-13 BLAST
ZnF_C3H1 207 232 2.49e1 SMART
ZnF_C3H1 243 276 9.28e-1 SMART
ZnF_C3H1 285 312 8.47e-4 SMART
low complexity region 371 412 N/A INTRINSIC
low complexity region 463 495 N/A INTRINSIC
low complexity region 499 505 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
coiled coil region 561 642 N/A INTRINSIC
RING 686 720 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088307
SMART Domains Protein: ENSMUSP00000137122
Gene: ENSMUSG00000067722

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:CCSMST1 49 121 6.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160785
SMART Domains Protein: ENSMUSP00000124121
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
low complexity region 36 44 N/A INTRINSIC
Blast:ZnF_C3H1 51 78 3e-12 BLAST
Blast:ZnF_C3H1 90 119 2e-13 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000160896
SMART Domains Protein: ENSMUSP00000124276
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
ZnF_C3H1 21 46 2.49e1 SMART
ZnF_C3H1 57 90 9.28e-1 SMART
ZnF_C3H1 99 126 8.47e-4 SMART
low complexity region 185 226 N/A INTRINSIC
low complexity region 277 309 N/A INTRINSIC
low complexity region 313 319 N/A INTRINSIC
low complexity region 325 341 N/A INTRINSIC
coiled coil region 375 456 N/A INTRINSIC
RING 500 534 4.13e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RING finger protein that may function in Rac signaling. It can bind to Brg/Brm-associated factor 60b and can promote its ubiquitination. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Unkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Unkl APN 17 25210848 missense probably benign 0.00
IGL02011:Unkl APN 17 25218591 missense probably damaging 1.00
IGL02141:Unkl APN 17 25229434 missense probably damaging 1.00
R0226:Unkl UTSW 17 25230711 missense probably damaging 0.96
R0394:Unkl UTSW 17 25230777 critical splice donor site probably null
R0638:Unkl UTSW 17 25208083 splice site probably benign
R1364:Unkl UTSW 17 25189623 missense probably benign
R1596:Unkl UTSW 17 25205733 missense probably null 1.00
R1899:Unkl UTSW 17 25229460 unclassified probably null
R1960:Unkl UTSW 17 25209645 splice site probably benign
R3927:Unkl UTSW 17 25229329 missense probably damaging 0.99
R5164:Unkl UTSW 17 25213109 splice site probably null
R5481:Unkl UTSW 17 25201172 nonsense probably null
R5520:Unkl UTSW 17 25205610 missense probably damaging 1.00
R5559:Unkl UTSW 17 25205713 missense probably benign 0.00
R6267:Unkl UTSW 17 25231865 makesense probably null
R6296:Unkl UTSW 17 25231865 makesense probably null
R6883:Unkl UTSW 17 25230333 missense probably damaging 1.00
R6979:Unkl UTSW 17 25199916 missense probably damaging 1.00
R7752:Unkl UTSW 17 25218653 missense probably damaging 1.00
R7901:Unkl UTSW 17 25218653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAACCTGTGTGTCACCCC -3'
(R):5'- TTCCAGATGGACTGCAAGC -3'

Sequencing Primer
(F):5'- TGGCGTGCCCGGGGGTGTggc -3'
(R):5'- TCAACCTCAGGCAGCGACTG -3'
Posted On2015-03-25