Incidental Mutation 'R3774:Msh6'
ID273524
Institutional Source Beutler Lab
Gene Symbol Msh6
Ensembl Gene ENSMUSG00000005370
Gene NamemutS homolog 6
SynonymsGTBP, Gtmbp, Msh6
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location87975050-87990883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87986181 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 788 (R788L)
Ref Sequence ENSEMBL: ENSMUSP00000005503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005503] [ENSMUST00000005504]
Predicted Effect probably damaging
Transcript: ENSMUST00000005503
AA Change: R788L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005503
Gene: ENSMUSG00000005370
AA Change: R788L

DomainStartEndE-ValueType
low complexity region 23 46 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
PWWP 90 152 9.01e-30 SMART
low complexity region 198 212 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 373 389 N/A INTRINSIC
Pfam:MutS_I 406 525 4.7e-35 PFAM
Pfam:MutS_II 536 700 1.4e-10 PFAM
MUTSd 750 1100 4.56e-86 SMART
MUTSac 1125 1319 1.68e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000005504
SMART Domains Protein: ENSMUSP00000005504
Gene: ENSMUSG00000005371

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 21 73 N/A INTRINSIC
FBOX 162 202 2.44e-8 SMART
PbH1 398 420 1.37e3 SMART
PbH1 421 443 8.83e0 SMART
CASH 421 557 1.31e-7 SMART
PbH1 444 466 6.15e1 SMART
PbH1 467 489 1.78e3 SMART
PbH1 490 512 2.29e2 SMART
PbH1 513 535 7.67e2 SMART
PbH1 536 558 1.36e0 SMART
PbH1 559 581 3.59e0 SMART
CASH 573 695 2.35e0 SMART
PbH1 582 604 8.73e2 SMART
PbH1 605 627 4.28e2 SMART
PbH1 628 650 5.03e2 SMART
PbH1 651 673 3.79e1 SMART
PbH1 674 696 4.73e0 SMART
PbH1 697 719 1.86e2 SMART
CASH 711 840 9.31e-13 SMART
PbH1 720 742 2.91e0 SMART
PbH1 743 765 3.73e2 SMART
PbH1 766 788 1.62e2 SMART
PbH1 789 811 9.99e1 SMART
PbH1 812 833 1.21e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130379
SMART Domains Protein: ENSMUSP00000121206
Gene: ENSMUSG00000005371

DomainStartEndE-ValueType
FBOX 87 127 2.44e-8 SMART
PbH1 323 345 1.37e3 SMART
PbH1 346 368 8.83e0 SMART
CASH 346 482 1.31e-7 SMART
PbH1 369 391 6.15e1 SMART
PbH1 392 414 1.78e3 SMART
PbH1 415 437 2.29e2 SMART
PbH1 438 460 7.67e2 SMART
PbH1 461 483 1.36e0 SMART
PbH1 484 506 3.59e0 SMART
CASH 498 620 2.35e0 SMART
PbH1 507 529 8.73e2 SMART
PbH1 530 552 4.28e2 SMART
PbH1 553 575 5.03e2 SMART
PbH1 576 598 3.79e1 SMART
PbH1 599 621 4.73e0 SMART
PbH1 622 644 1.86e2 SMART
CASH 636 765 9.31e-13 SMART
PbH1 645 667 2.91e0 SMART
PbH1 668 690 3.73e2 SMART
PbH1 691 713 1.62e2 SMART
PbH1 714 736 9.99e1 SMART
PbH1 737 758 1.21e3 SMART
Meta Mutation Damage Score 0.9665 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Msh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Msh6 APN 17 87985479 missense probably benign
IGL01834:Msh6 APN 17 87985712 missense probably damaging 1.00
IGL01904:Msh6 APN 17 87984732 missense probably benign
IGL01957:Msh6 APN 17 87985091 missense possibly damaging 0.73
IGL02117:Msh6 APN 17 87990806 unclassified probably benign
IGL02234:Msh6 APN 17 87986801 missense probably damaging 1.00
IGL02512:Msh6 APN 17 87984732 missense probably benign
IGL02651:Msh6 APN 17 87989515 missense probably damaging 1.00
IGL03381:Msh6 APN 17 87985109 missense probably damaging 1.00
medea UTSW 17 87980223 nonsense probably null
medusa UTSW 17 87988463 unclassified probably benign
PIT4449001:Msh6 UTSW 17 87986188 missense probably damaging 0.96
R0196:Msh6 UTSW 17 87980360 missense possibly damaging 0.95
R0324:Msh6 UTSW 17 87986620 nonsense probably null
R0492:Msh6 UTSW 17 87975251 missense probably benign
R0711:Msh6 UTSW 17 87986684 missense probably damaging 1.00
R1065:Msh6 UTSW 17 87988463 unclassified probably benign
R1454:Msh6 UTSW 17 87984758 missense probably benign 0.00
R1740:Msh6 UTSW 17 87985722 missense possibly damaging 0.72
R1770:Msh6 UTSW 17 87980223 nonsense probably null
R1771:Msh6 UTSW 17 87984522 missense probably benign 0.17
R1919:Msh6 UTSW 17 87985125 missense probably benign 0.01
R1926:Msh6 UTSW 17 87986225 missense probably benign
R2026:Msh6 UTSW 17 87990343 missense probably damaging 1.00
R2095:Msh6 UTSW 17 87988233 missense possibly damaging 0.93
R2097:Msh6 UTSW 17 87985416 missense probably benign 0.00
R2149:Msh6 UTSW 17 87986088 missense probably damaging 1.00
R2156:Msh6 UTSW 17 87986140 nonsense probably null
R2167:Msh6 UTSW 17 87989483 missense probably damaging 1.00
R2382:Msh6 UTSW 17 87984731 missense probably benign
R3005:Msh6 UTSW 17 87988285 missense probably benign 0.34
R3160:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3162:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3162:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3775:Msh6 UTSW 17 87986181 missense probably damaging 1.00
R4350:Msh6 UTSW 17 87984584 missense probably damaging 1.00
R4424:Msh6 UTSW 17 87990789 nonsense probably null
R4499:Msh6 UTSW 17 87980269 missense probably damaging 1.00
R4667:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4668:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4669:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4849:Msh6 UTSW 17 87983519 missense possibly damaging 0.94
R5137:Msh6 UTSW 17 87980288 missense possibly damaging 0.83
R5472:Msh6 UTSW 17 87984561 missense possibly damaging 0.81
R5594:Msh6 UTSW 17 87986069 missense probably benign 0.00
R5607:Msh6 UTSW 17 87986901 missense probably damaging 1.00
R5608:Msh6 UTSW 17 87986901 missense probably damaging 1.00
R5660:Msh6 UTSW 17 87984719 missense possibly damaging 0.94
R6243:Msh6 UTSW 17 87983571 missense possibly damaging 0.69
R6279:Msh6 UTSW 17 87980249 missense probably damaging 1.00
R6357:Msh6 UTSW 17 87984460 nonsense probably null
R6399:Msh6 UTSW 17 87986891 missense probably damaging 1.00
R6453:Msh6 UTSW 17 87985739 missense probably damaging 1.00
R6646:Msh6 UTSW 17 87986442 missense possibly damaging 0.80
R7404:Msh6 UTSW 17 87975120
R7837:Msh6 UTSW 17 87984666 missense probably damaging 1.00
R8004:Msh6 UTSW 17 87986787 missense probably damaging 1.00
R8296:Msh6 UTSW 17 87986912 missense probably damaging 1.00
X0026:Msh6 UTSW 17 87986181 missense probably damaging 1.00
X0026:Msh6 UTSW 17 87990614 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAAGCCAGTCAGCGGATGG -3'
(R):5'- GAATCCTTCTAGAGCAGAGAGAAAATC -3'

Sequencing Primer
(F):5'- TCAGCGGATGGTGCTAGAC -3'
(R):5'- AGCAGAGAGAAAATCAATGATCTTC -3'
Posted On2015-03-25