Incidental Mutation 'R3774:Iws1'
ID273525
Institutional Source Beutler Lab
Gene Symbol Iws1
Ensembl Gene ENSMUSG00000024384
Gene NameIWS1, SUPT6 interacting protein
Synonyms1700069O15Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location32067741-32104328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32079995 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 159 (S159P)
Ref Sequence ENSEMBL: ENSMUSP00000025243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025243] [ENSMUST00000212675]
Predicted Effect probably damaging
Transcript: ENSMUST00000025243
AA Change: S159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025243
Gene: ENSMUSG00000024384
AA Change: S159P

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 73 86 N/A INTRINSIC
low complexity region 92 109 N/A INTRINSIC
internal_repeat_2 112 179 9.21e-13 PROSPERO
internal_repeat_1 118 184 9.82e-20 PROSPERO
internal_repeat_1 183 296 9.82e-20 PROSPERO
internal_repeat_2 229 316 9.21e-13 PROSPERO
low complexity region 320 332 N/A INTRINSIC
low complexity region 357 373 N/A INTRINSIC
low complexity region 384 404 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
Pfam:Med26 584 636 4.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212115
Predicted Effect probably benign
Transcript: ENSMUST00000212280
Predicted Effect probably damaging
Transcript: ENSMUST00000212675
AA Change: S159P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000213074
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Iws1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Iws1 APN 18 32084688 missense probably benign 0.07
IGL01432:Iws1 APN 18 32083466 splice site probably benign
IGL01647:Iws1 APN 18 32097222 nonsense probably null
IGL02054:Iws1 APN 18 32090542 critical splice donor site probably null
IGL02189:Iws1 APN 18 32093125 missense probably damaging 1.00
IGL02664:Iws1 APN 18 32070164 missense possibly damaging 0.81
IGL03384:Iws1 APN 18 32093150 missense probably damaging 1.00
IGL03394:Iws1 APN 18 32088248 splice site probably benign
R0352:Iws1 UTSW 18 32084205 missense probably damaging 1.00
R1385:Iws1 UTSW 18 32090430 missense probably benign 0.03
R1486:Iws1 UTSW 18 32097256 missense probably damaging 1.00
R1526:Iws1 UTSW 18 32080125 missense probably benign 0.00
R1529:Iws1 UTSW 18 32080281 missense probably benign
R2094:Iws1 UTSW 18 32084666 missense probably damaging 1.00
R3907:Iws1 UTSW 18 32079920 missense possibly damaging 0.93
R4018:Iws1 UTSW 18 32070152 nonsense probably null
R4423:Iws1 UTSW 18 32083450 missense probably damaging 1.00
R4703:Iws1 UTSW 18 32080013 missense probably benign 0.19
R4979:Iws1 UTSW 18 32093267 unclassified probably benign
R5228:Iws1 UTSW 18 32088261 missense probably damaging 1.00
R5352:Iws1 UTSW 18 32083404 missense probably damaging 1.00
R6428:Iws1 UTSW 18 32086290 missense probably damaging 1.00
R6846:Iws1 UTSW 18 32086273 unclassified probably benign
R6892:Iws1 UTSW 18 32086274 missense probably damaging 0.99
R7163:Iws1 UTSW 18 32093224 missense possibly damaging 0.80
R7540:Iws1 UTSW 18 32080483 missense possibly damaging 0.94
R7605:Iws1 UTSW 18 32089487 missense probably benign 0.01
R7714:Iws1 UTSW 18 32090515 missense probably benign 0.00
R8218:Iws1 UTSW 18 32093635 missense probably benign 0.00
R8229:Iws1 UTSW 18 32084687 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTCTGAGGAGCATGCAGAG -3'
(R):5'- GTCCTCACTTTCAGAGTCGC -3'

Sequencing Primer
(F):5'- TGAGGAGCATGCAGAGTCTCC -3'
(R):5'- AGTCGCTGACTCGGGGTTTG -3'
Posted On2015-03-25