Incidental Mutation 'R3774:Mxi1'
ID273529
Institutional Source Beutler Lab
Gene Symbol Mxi1
Ensembl Gene ENSMUSG00000025025
Gene NameMAX interactor 1, dimerization protein
SynonymsMad2, bHLHc11
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location53310506-53375810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53371729 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 294 (A294E)
Ref Sequence ENSEMBL: ENSMUSP00000003870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003870] [ENSMUST00000025998] [ENSMUST00000086887] [ENSMUST00000111737]
Predicted Effect probably benign
Transcript: ENSMUST00000003870
AA Change: A294E

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000003870
Gene: ENSMUSG00000025025
AA Change: A294E

DomainStartEndE-ValueType
low complexity region 16 45 N/A INTRINSIC
HLH 140 192 4.4e-11 SMART
low complexity region 230 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025998
AA Change: A227E

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025998
Gene: ENSMUSG00000025025
AA Change: A227E

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
HLH 73 125 4.4e-11 SMART
low complexity region 163 185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086887
AA Change: R13L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000111737
AA Change: A191E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107366
Gene: ENSMUSG00000025025
AA Change: A191E

DomainStartEndE-ValueType
HLH 37 89 4.4e-11 SMART
low complexity region 127 149 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing a helix-loop-helix domain characteristic of transcription factors, which allows heterodimerization and sequence-specific DNA binding. The encoded protein is related to a family of Myc/Max/Mad proteins that are involved in the regulation of several cellular processes. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate Myc function. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show multisystem anomalies including progressive hyperplasia in the spleen and prostate, degenerative changes in the kidney, and increased sensitivity to carcinogens. In addition, mutant embryo fibroblasts are more prone to transformation by the Myc and Ras oncogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Mxi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1895:Mxi1 UTSW 19 53370344 missense probably benign 0.13
R3691:Mxi1 UTSW 19 53369631 missense probably damaging 1.00
R3775:Mxi1 UTSW 19 53371729 missense probably benign 0.18
R3776:Mxi1 UTSW 19 53371729 missense probably benign 0.18
R4020:Mxi1 UTSW 19 53371729 missense probably benign 0.18
R4825:Mxi1 UTSW 19 53370338 nonsense probably null
R4832:Mxi1 UTSW 19 53370314 missense probably damaging 1.00
R7469:Mxi1 UTSW 19 53371660 missense probably damaging 1.00
R7480:Mxi1 UTSW 19 53371635 missense possibly damaging 0.91
R7487:Mxi1 UTSW 19 53371657 missense probably damaging 1.00
R7891:Mxi1 UTSW 19 53310761 missense probably benign 0.00
R8236:Mxi1 UTSW 19 53369598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGCAGATTATTAATGCCCC -3'
(R):5'- TTCTACCAGGGAGGCTCTAC -3'

Sequencing Primer
(F):5'- TGTTTTCTCTTTCTTCCTCCCG -3'
(R):5'- GGGAGGCTCTACCCCACTTTTC -3'
Posted On2015-03-25