Incidental Mutation 'R3775:Fam185a'
ID273544
Institutional Source Beutler Lab
Gene Symbol Fam185a
Ensembl Gene ENSMUSG00000047221
Gene Namefamily with sequence similarity 185, member A
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3775 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21424958-21482124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21455806 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 273 (A273D)
Ref Sequence ENSEMBL: ENSMUSP00000058333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056045]
Predicted Effect probably damaging
Transcript: ENSMUST00000056045
AA Change: A273D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058333
Gene: ENSMUSG00000047221
AA Change: A273D

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146056
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,009,023 E2557G possibly damaging Het
Arid1a A G 4: 133,686,764 S1248P unknown Het
C2cd3 T C 7: 100,431,998 L1327S probably damaging Het
Ccnh T C 13: 85,206,124 probably benign Het
Dcdc5 C A 2: 106,372,393 noncoding transcript Het
Eprs T C 1: 185,373,008 F160S probably damaging Het
F9 A G X: 60,018,985 I190V probably benign Het
Fhod1 G A 8: 105,331,638 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hipk2 T C 6: 38,743,094 D534G probably damaging Het
Ints6l T C X: 56,481,371 L220S probably damaging Het
Kat7 T C 11: 95,291,531 T250A probably benign Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mpp3 G T 11: 102,023,367 S134* probably null Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nlrp1b T C 11: 71,156,300 probably benign Het
Npy1r T C 8: 66,704,850 F271L possibly damaging Het
Nup160 G T 2: 90,722,076 C1132F probably benign Het
Olfr1341 C T 4: 118,710,154 T249I probably damaging Het
Olfr97 T A 17: 37,232,230 I47F probably damaging Het
Pcdhga5 A G 18: 37,695,114 E205G possibly damaging Het
Pdgfc A G 3: 81,141,551 T89A probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Pgr15l G T X: 97,077,141 R181M probably damaging Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rnf112 A T 11: 61,450,185 probably benign Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Slc25a19 A G 11: 115,615,459 Y303H probably damaging Het
Sympk T C 7: 19,035,955 F186L probably damaging Het
Tek A G 4: 94,804,312 D219G probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn2r29 C G 7: 7,240,012 D500H probably damaging Het
Other mutations in Fam185a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Fam185a APN 5 21480342 missense probably damaging 1.00
IGL01980:Fam185a APN 5 21459173 missense probably damaging 1.00
IGL02096:Fam185a APN 5 21425343 missense probably damaging 1.00
IGL02264:Fam185a APN 5 21480394 missense possibly damaging 0.63
IGL02553:Fam185a APN 5 21455831 missense probably damaging 1.00
IGL02553:Fam185a APN 5 21429841 splice site probably benign
IGL03082:Fam185a APN 5 21455838 missense possibly damaging 0.49
famine UTSW 5 21425454 missense probably benign 0.00
R0389:Fam185a UTSW 5 21459285 missense probably damaging 0.99
R1872:Fam185a UTSW 5 21480330 critical splice acceptor site probably null
R1883:Fam185a UTSW 5 21425244 missense possibly damaging 0.85
R4190:Fam185a UTSW 5 21425124 unclassified probably benign
R4192:Fam185a UTSW 5 21425124 unclassified probably benign
R4194:Fam185a UTSW 5 21425454 missense probably benign 0.00
R4704:Fam185a UTSW 5 21480473 utr 3 prime probably benign
R4724:Fam185a UTSW 5 21455787 missense probably damaging 1.00
R4837:Fam185a UTSW 5 21480377 missense probably benign 0.00
R6225:Fam185a UTSW 5 21425556 missense probably damaging 0.99
R6438:Fam185a UTSW 5 21458972 splice site probably null
R6475:Fam185a UTSW 5 21425283 missense probably benign 0.01
R7512:Fam185a UTSW 5 21447358 critical splice donor site probably null
R8400:Fam185a UTSW 5 21438816 missense probably benign 0.14
R8690:Fam185a UTSW 5 21433768 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AGAACTCTGTTTTATTAGTTATCTGGG -3'
(R):5'- GAAAATCTGACCACCTGCCTC -3'

Sequencing Primer
(F):5'- ATGTCAAAGCAGGGCCT -3'
(R):5'- TGACCACCTGCCTCCCAAATATTC -3'
Posted On2015-03-25