Incidental Mutation 'R3775:Gpat4'
ID273551
Institutional Source Beutler Lab
Gene Symbol Gpat4
Ensembl Gene ENSMUSG00000031545
Gene Nameglycerol-3-phosphate acyltransferase 4
SynonymsAgpat6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R3775 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location23171265-23208346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23180155 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 286 (P286L)
Ref Sequence ENSEMBL: ENSMUSP00000127325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167004] [ENSMUST00000209507]
Predicted Effect probably damaging
Transcript: ENSMUST00000167004
AA Change: P286L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127325
Gene: ENSMUSG00000031545
AA Change: P286L

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 156 175 N/A INTRINSIC
transmembrane domain 180 202 N/A INTRINSIC
PlsC 242 353 9.31e-24 SMART
Blast:PlsC 368 413 7e-18 BLAST
low complexity region 414 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211260
Meta Mutation Damage Score 0.9423 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysophosphatidic acid acyltransferases (EC 2.3.1.51) catalyze the conversion of lysophosphatidic acid (LPA) to phosphatidic acid (PA). LPA and PA are involved in signal transduction and lipid biosynthesis.[supplied by OMIM, Apr 2004]
PHENOTYPE: Nursing mothers homozygous for a gene trap allele display underdeveloped mammary glands that are depleted in intracellular fat droplets and lack the ability to produce diacylglycerol- and triacylglycerol-rich milk; pups nursed by mutant mothers die neonatally unless transferred to foster mothers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,009,023 E2557G possibly damaging Het
Arid1a A G 4: 133,686,764 S1248P unknown Het
C2cd3 T C 7: 100,431,998 L1327S probably damaging Het
Ccnh T C 13: 85,206,124 probably benign Het
Dcdc5 C A 2: 106,372,393 noncoding transcript Het
Eprs T C 1: 185,373,008 F160S probably damaging Het
F9 A G X: 60,018,985 I190V probably benign Het
Fam185a C A 5: 21,455,806 A273D probably damaging Het
Fhod1 G A 8: 105,331,638 probably benign Het
Hipk2 T C 6: 38,743,094 D534G probably damaging Het
Ints6l T C X: 56,481,371 L220S probably damaging Het
Kat7 T C 11: 95,291,531 T250A probably benign Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mpp3 G T 11: 102,023,367 S134* probably null Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nlrp1b T C 11: 71,156,300 probably benign Het
Npy1r T C 8: 66,704,850 F271L possibly damaging Het
Nup160 G T 2: 90,722,076 C1132F probably benign Het
Olfr1341 C T 4: 118,710,154 T249I probably damaging Het
Olfr97 T A 17: 37,232,230 I47F probably damaging Het
Pcdhga5 A G 18: 37,695,114 E205G possibly damaging Het
Pdgfc A G 3: 81,141,551 T89A probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Pgr15l G T X: 97,077,141 R181M probably damaging Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rnf112 A T 11: 61,450,185 probably benign Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Slc25a19 A G 11: 115,615,459 Y303H probably damaging Het
Sympk T C 7: 19,035,955 F186L probably damaging Het
Tek A G 4: 94,804,312 D219G probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn2r29 C G 7: 7,240,012 D500H probably damaging Het
Other mutations in Gpat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gpat4 APN 8 23182775 missense probably damaging 0.97
IGL01660:Gpat4 APN 8 23175338 critical splice donor site probably null
IGL01688:Gpat4 APN 8 23181845 missense probably benign 0.03
IGL02749:Gpat4 APN 8 23180870 missense probably damaging 1.00
R0076:Gpat4 UTSW 8 23190705 splice site probably benign
R0362:Gpat4 UTSW 8 23180933 missense probably benign 0.05
R0961:Gpat4 UTSW 8 23180911 missense probably damaging 0.96
R1876:Gpat4 UTSW 8 23179470 missense possibly damaging 0.82
R1959:Gpat4 UTSW 8 23182936 missense possibly damaging 0.81
R2217:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2313:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2315:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2969:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3110:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3112:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3774:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3826:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3828:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3829:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3830:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3943:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3944:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R4384:Gpat4 UTSW 8 23174586 missense probably benign 0.05
R4685:Gpat4 UTSW 8 23182849 utr 5 prime probably benign
R5120:Gpat4 UTSW 8 23180202 missense possibly damaging 0.77
R5199:Gpat4 UTSW 8 23182696 missense possibly damaging 0.46
R5491:Gpat4 UTSW 8 23180664 missense probably benign 0.38
R8393:Gpat4 UTSW 8 23179482 unclassified probably benign
R8395:Gpat4 UTSW 8 23179482 unclassified probably benign
R8396:Gpat4 UTSW 8 23179482 unclassified probably benign
X0062:Gpat4 UTSW 8 23190711 splice site probably null
X0064:Gpat4 UTSW 8 23175394 missense probably damaging 1.00
Z1176:Gpat4 UTSW 8 23179798 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATGGACCATTTGCCCCAC -3'
(R):5'- CTCACAACCAGGGGTCTAAAG -3'

Sequencing Primer
(F):5'- CACAGTTCCAAATTTGTTTATTGGG -3'
(R):5'- CACAACCAGGGGTCTAAAGAGTGG -3'
Posted On2015-03-25