Incidental Mutation 'R3775:Naip5'
ID 273564
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene Name NLR family, apoptosis inhibitory protein 5
Synonyms Birc1e, Naip-rs3, Lgn1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R3775 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 100348247-100382831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100359883 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 451 (E451G)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
AlphaFold Q9R016
Predicted Effect probably benign
Transcript: ENSMUST00000049789
AA Change: E451G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: E451G

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 8,986,387 (GRCm39) E2557G possibly damaging Het
Arid1a A G 4: 133,414,075 (GRCm39) S1248P unknown Het
C2cd3 T C 7: 100,081,205 (GRCm39) L1327S probably damaging Het
Ccnh T C 13: 85,354,243 (GRCm39) probably benign Het
Dcdc5 C A 2: 106,202,738 (GRCm39) noncoding transcript Het
Eprs1 T C 1: 185,105,205 (GRCm39) F160S probably damaging Het
F9 A G X: 59,064,345 (GRCm39) I190V probably benign Het
Fam185a C A 5: 21,660,804 (GRCm39) A273D probably damaging Het
Fhod1 G A 8: 106,058,270 (GRCm39) probably benign Het
Gpat4 G A 8: 23,670,171 (GRCm39) P286L probably damaging Het
Hipk2 T C 6: 38,720,029 (GRCm39) D534G probably damaging Het
Ints6l T C X: 55,526,731 (GRCm39) L220S probably damaging Het
Kat7 T C 11: 95,182,357 (GRCm39) T250A probably benign Het
Kif23 G A 9: 61,832,274 (GRCm39) S623L probably benign Het
Krt32 A G 11: 99,978,947 (GRCm39) C36R probably benign Het
Megf10 G A 18: 57,410,177 (GRCm39) G653S probably damaging Het
Mpp3 G T 11: 101,914,193 (GRCm39) S134* probably null Het
Msh6 G T 17: 88,293,609 (GRCm39) R788L probably damaging Het
Mxi1 C A 19: 53,360,160 (GRCm39) A294E probably benign Het
Nlrp1b T C 11: 71,047,126 (GRCm39) probably benign Het
Npy1r T C 8: 67,157,502 (GRCm39) F271L possibly damaging Het
Nup160 G T 2: 90,552,420 (GRCm39) C1132F probably benign Het
Or13p3 C T 4: 118,567,351 (GRCm39) T249I probably damaging Het
Or1o2 T A 17: 37,543,121 (GRCm39) I47F probably damaging Het
Pcdhga5 A G 18: 37,828,167 (GRCm39) E205G possibly damaging Het
Pdgfc A G 3: 81,048,858 (GRCm39) T89A probably damaging Het
Pecr A G 1: 72,298,530 (GRCm39) F297L probably benign Het
Pgr15l G T X: 96,120,747 (GRCm39) R181M probably damaging Het
Pomgnt1 G A 4: 116,011,325 (GRCm39) R230H probably damaging Het
Ppm1d T C 11: 85,227,993 (GRCm39) I303T probably damaging Het
Ptprc T G 1: 137,992,511 (GRCm39) Q1205H probably damaging Het
Rnf112 A T 11: 61,341,011 (GRCm39) probably benign Het
Slc25a13 T A 6: 6,109,288 (GRCm39) Q358L probably damaging Het
Slc25a19 A G 11: 115,506,285 (GRCm39) Y303H probably damaging Het
Sympk T C 7: 18,769,880 (GRCm39) F186L probably damaging Het
Tek A G 4: 94,692,549 (GRCm39) D219G probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Tnik T C 3: 28,692,568 (GRCm39) Y820H probably damaging Het
Tnrc6c C T 11: 117,614,355 (GRCm39) R838W probably damaging Het
Vmn2r29 C G 7: 7,243,011 (GRCm39) D500H probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100,382,683 (GRCm39) nonsense probably null
IGL00493:Naip5 APN 13 100,367,279 (GRCm39) missense probably damaging 0.96
IGL01294:Naip5 APN 13 100,353,588 (GRCm39) missense probably damaging 0.99
IGL01405:Naip5 APN 13 100,358,453 (GRCm39) missense probably benign 0.11
IGL01568:Naip5 APN 13 100,353,609 (GRCm39) missense probably benign 0.26
IGL01804:Naip5 APN 13 100,358,092 (GRCm39) missense probably damaging 1.00
IGL02012:Naip5 APN 13 100,359,847 (GRCm39) missense probably benign 0.01
IGL02183:Naip5 APN 13 100,358,150 (GRCm39) missense probably benign 0.41
IGL02449:Naip5 APN 13 100,358,683 (GRCm39) missense probably benign 0.34
IGL02815:Naip5 APN 13 100,359,239 (GRCm39) missense probably benign
IGL02992:Naip5 APN 13 100,359,536 (GRCm39) missense probably damaging 1.00
IGL03027:Naip5 APN 13 100,359,524 (GRCm39) missense probably benign 0.00
IGL03234:Naip5 APN 13 100,349,135 (GRCm39) missense probably damaging 1.00
inwood2 UTSW 13 100,359,522 (GRCm39) nonsense probably null
inwood3 UTSW 13 100,358,411 (GRCm39) nonsense probably null
Nuchal UTSW 13 100,351,171 (GRCm39) missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100,356,268 (GRCm39) missense probably benign 0.00
PIT4131001:Naip5 UTSW 13 100,356,247 (GRCm39) missense probably benign
R0001:Naip5 UTSW 13 100,359,622 (GRCm39) missense probably benign
R0001:Naip5 UTSW 13 100,351,158 (GRCm39) critical splice donor site probably null
R0462:Naip5 UTSW 13 100,358,240 (GRCm39) missense probably damaging 1.00
R0636:Naip5 UTSW 13 100,356,196 (GRCm39) missense probably benign
R0674:Naip5 UTSW 13 100,359,707 (GRCm39) missense probably benign 0.04
R0764:Naip5 UTSW 13 100,353,613 (GRCm39) missense probably benign 0.03
R0837:Naip5 UTSW 13 100,367,251 (GRCm39) missense probably benign
R1179:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R1302:Naip5 UTSW 13 100,358,099 (GRCm39) missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100,356,225 (GRCm39) missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100,358,714 (GRCm39) missense probably benign
R1638:Naip5 UTSW 13 100,349,177 (GRCm39) missense probably damaging 1.00
R1651:Naip5 UTSW 13 100,358,419 (GRCm39) missense probably benign 0.41
R1707:Naip5 UTSW 13 100,379,363 (GRCm39) missense probably damaging 1.00
R1835:Naip5 UTSW 13 100,359,726 (GRCm39) nonsense probably null
R1836:Naip5 UTSW 13 100,356,195 (GRCm39) missense probably benign 0.18
R1972:Naip5 UTSW 13 100,349,278 (GRCm39) missense probably damaging 0.98
R2080:Naip5 UTSW 13 100,358,041 (GRCm39) missense probably damaging 1.00
R2333:Naip5 UTSW 13 100,359,679 (GRCm39) missense probably damaging 1.00
R2348:Naip5 UTSW 13 100,356,246 (GRCm39) missense probably benign 0.01
R3055:Naip5 UTSW 13 100,358,386 (GRCm39) missense probably benign 0.23
R3401:Naip5 UTSW 13 100,358,411 (GRCm39) nonsense probably null
R3723:Naip5 UTSW 13 100,359,522 (GRCm39) nonsense probably null
R3775:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R4019:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4019:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R4020:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R4020:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4074:Naip5 UTSW 13 100,382,572 (GRCm39) missense probably damaging 1.00
R4082:Naip5 UTSW 13 100,382,338 (GRCm39) missense probably damaging 1.00
R4105:Naip5 UTSW 13 100,356,247 (GRCm39) missense probably benign
R4227:Naip5 UTSW 13 100,349,276 (GRCm39) missense probably damaging 0.99
R4639:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4640:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4641:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4644:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4645:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4700:Naip5 UTSW 13 100,359,922 (GRCm39) missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100,358,378 (GRCm39) missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100,358,639 (GRCm39) missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100,356,189 (GRCm39) missense probably benign 0.32
R4816:Naip5 UTSW 13 100,356,195 (GRCm39) missense probably benign 0.01
R4816:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R4869:Naip5 UTSW 13 100,381,639 (GRCm39) missense probably damaging 1.00
R5162:Naip5 UTSW 13 100,359,914 (GRCm39) missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100,382,170 (GRCm39) missense probably benign 0.08
R5411:Naip5 UTSW 13 100,382,254 (GRCm39) missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100,367,170 (GRCm39) splice site probably null
R5760:Naip5 UTSW 13 100,379,346 (GRCm39) missense probably damaging 1.00
R5916:Naip5 UTSW 13 100,359,209 (GRCm39) missense probably benign 0.02
R6302:Naip5 UTSW 13 100,359,674 (GRCm39) missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100,359,674 (GRCm39) missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100,359,913 (GRCm39) missense probably benign 0.01
R6474:Naip5 UTSW 13 100,351,171 (GRCm39) missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100,358,102 (GRCm39) missense probably benign
R6544:Naip5 UTSW 13 100,359,652 (GRCm39) missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100,382,437 (GRCm39) missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100,359,922 (GRCm39) missense probably damaging 0.99
R7052:Naip5 UTSW 13 100,358,855 (GRCm39) missense probably benign 0.01
R7138:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7141:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7375:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7375:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7401:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7401:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7447:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7447:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7466:Naip5 UTSW 13 100,358,494 (GRCm39) nonsense probably null
R7491:Naip5 UTSW 13 100,353,579 (GRCm39) missense probably benign 0.18
R7559:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7559:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7562:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7562:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7588:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7588:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7589:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7589:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7590:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7590:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7742:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7886:Naip5 UTSW 13 100,382,689 (GRCm39) missense probably benign 0.28
R7996:Naip5 UTSW 13 100,358,164 (GRCm39) missense probably damaging 1.00
R8026:Naip5 UTSW 13 100,382,406 (GRCm39) missense probably damaging 1.00
R8046:Naip5 UTSW 13 100,358,741 (GRCm39) missense probably benign
R8319:Naip5 UTSW 13 100,358,167 (GRCm39) missense probably benign 0.12
R8471:Naip5 UTSW 13 100,358,153 (GRCm39) missense probably damaging 0.99
R8480:Naip5 UTSW 13 100,358,743 (GRCm39) missense probably damaging 1.00
R8496:Naip5 UTSW 13 100,349,247 (GRCm39) missense probably benign 0.00
R8500:Naip5 UTSW 13 100,359,220 (GRCm39) missense probably damaging 0.98
R8712:Naip5 UTSW 13 100,359,604 (GRCm39) missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8781:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8788:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8817:Naip5 UTSW 13 100,349,207 (GRCm39) missense probably benign 0.01
R8833:Naip5 UTSW 13 100,359,442 (GRCm39) missense probably damaging 0.97
R8835:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8958:Naip5 UTSW 13 100,354,117 (GRCm39) nonsense probably null
R9031:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9032:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9074:Naip5 UTSW 13 100,358,264 (GRCm39) missense possibly damaging 0.92
R9098:Naip5 UTSW 13 100,366,127 (GRCm39) missense possibly damaging 0.67
R9204:Naip5 UTSW 13 100,359,008 (GRCm39) missense probably damaging 1.00
R9223:Naip5 UTSW 13 100,364,184 (GRCm39) missense probably benign 0.05
R9358:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9389:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9403:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9518:Naip5 UTSW 13 100,358,367 (GRCm39) missense probably benign
R9568:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9568:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9569:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9569:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9570:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9572:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9581:Naip5 UTSW 13 100,351,194 (GRCm39) missense probably benign 0.11
R9627:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9725:Naip5 UTSW 13 100,358,784 (GRCm39) missense possibly damaging 0.94
R9763:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
R9764:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
R9765:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGATGTTGGCCAGTCCCTG -3'
(R):5'- TCCACAGACTTGGGTAGGAGTG -3'

Sequencing Primer
(F):5'- CCCTGATCTGGTGTGATGGAACTAAG -3'
(R):5'- CTTGGGTAGGAGTGAAGCCC -3'
Posted On 2015-03-25