Incidental Mutation 'R3776:Glt1d1'
ID273588
Institutional Source Beutler Lab
Gene Symbol Glt1d1
Ensembl Gene ENSMUSG00000049971
Gene Nameglycosyltransferase 1 domain containing 1
Synonyms5730455A04Rik
MMRRC Submission 040874-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3776 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location127632262-127709374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127694311 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 289 (F289I)
Ref Sequence ENSEMBL: ENSMUSP00000113864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118139]
Predicted Effect probably damaging
Transcript: ENSMUST00000118139
AA Change: F289I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113864
Gene: ENSMUSG00000049971
AA Change: F289I

DomainStartEndE-ValueType
Pfam:Glycos_transf_1 153 319 8.2e-23 PFAM
Pfam:Glyco_trans_1_4 166 305 8.7e-15 PFAM
Pfam:Glyco_trans_1_2 244 335 8.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137157
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer1 C T 17: 56,955,111 V264M probably damaging Het
Adgrg1 C T 8: 95,009,655 S479F probably damaging Het
Ank2 T A 3: 126,942,262 probably benign Het
Atp2b1 CTTTTT CTTTTTT 10: 98,979,869 probably null Het
Ccdc88c G A 12: 100,947,179 T529M probably damaging Het
Cdc27 T G 11: 104,515,437 E617D probably damaging Het
Cfap54 A G 10: 93,045,100 V367A probably damaging Het
Col6a4 G A 9: 106,051,701 Q1445* probably null Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dll1 T C 17: 15,368,524 S630G probably benign Het
Ednra A G 8: 77,675,095 S189P probably damaging Het
Eif6 T A 2: 155,826,376 T20S possibly damaging Het
Fbxl5 A G 5: 43,758,276 V555A possibly damaging Het
Gdpd5 G A 7: 99,454,572 R422Q probably benign Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Helz2 G A 2: 181,240,389 R204* probably null Het
Hhex A T 19: 37,437,270 Q149L probably damaging Het
Kat2b A G 17: 53,567,581 probably null Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Klra2 A T 6: 131,242,963 L85H probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mpp3 G T 11: 102,023,367 S134* probably null Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Nin G T 12: 70,038,682 Q1592K possibly damaging Het
Nlrc5 A G 8: 94,472,839 E26G possibly damaging Het
Nup160 G T 2: 90,722,076 C1132F probably benign Het
Olfr1234 A T 2: 89,362,764 S222T possibly damaging Het
Pdgfc A G 3: 81,141,551 T89A probably damaging Het
Pdgfrb A G 18: 61,081,920 D1007G probably benign Het
Pgbd1 A G 13: 21,428,373 L98P probably benign Het
Pkhd1l1 G A 15: 44,514,975 probably null Het
Plod1 A G 4: 147,931,277 V105A possibly damaging Het
Polg2 G T 11: 106,779,284 F53L probably benign Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rab3gap2 T C 1: 185,277,205 L1086P probably damaging Het
Rnf19a T A 15: 36,265,912 N13I probably benign Het
Slc25a19 A G 11: 115,615,459 Y303H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Ubxn11 C T 4: 134,108,294 P4S probably damaging Het
Zg16 T A 7: 127,050,532 I86F probably damaging Het
Other mutations in Glt1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Glt1d1 APN 5 127632285 start codon destroyed probably null 1.00
IGL01310:Glt1d1 APN 5 127632320 missense possibly damaging 0.86
IGL01608:Glt1d1 APN 5 127664682 missense possibly damaging 0.56
IGL01738:Glt1d1 APN 5 127632355 intron probably benign
IGL02028:Glt1d1 APN 5 127706920 missense possibly damaging 0.63
IGL02273:Glt1d1 APN 5 127657144 splice site probably benign
IGL02603:Glt1d1 APN 5 127632345 missense probably damaging 1.00
IGL02718:Glt1d1 APN 5 127650699 missense probably damaging 0.98
IGL02850:Glt1d1 APN 5 127644345 missense probably benign 0.00
IGL03328:Glt1d1 APN 5 127657119 missense probably benign
R0049:Glt1d1 UTSW 5 127663327 splice site probably benign
R0312:Glt1d1 UTSW 5 127691070 missense probably damaging 1.00
R0400:Glt1d1 UTSW 5 127657075 splice site probably benign
R1838:Glt1d1 UTSW 5 127678129 missense probably benign 0.01
R2060:Glt1d1 UTSW 5 127657119 missense probably benign
R2262:Glt1d1 UTSW 5 127657112 missense probably benign 0.08
R4205:Glt1d1 UTSW 5 127689871 missense probably benign 0.32
R4249:Glt1d1 UTSW 5 127691112 critical splice donor site probably null
R4379:Glt1d1 UTSW 5 127694282 missense possibly damaging 0.73
R5044:Glt1d1 UTSW 5 127644414 missense probably benign 0.38
R5289:Glt1d1 UTSW 5 127644356 missense probably benign 0.11
R5374:Glt1d1 UTSW 5 127657084 splice site probably null
R5533:Glt1d1 UTSW 5 127691031 missense probably damaging 1.00
R5592:Glt1d1 UTSW 5 127657119 missense probably benign 0.01
R5870:Glt1d1 UTSW 5 127677280 missense probably damaging 1.00
R5942:Glt1d1 UTSW 5 127644470 splice site probably null
R6128:Glt1d1 UTSW 5 127677271 missense probably damaging 1.00
R6349:Glt1d1 UTSW 5 127706886 missense probably benign 0.10
R6490:Glt1d1 UTSW 5 127644296 intron probably null
R6502:Glt1d1 UTSW 5 127706981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAAATGATAGACGCTCGTGG -3'
(R):5'- AGATGCTGCGTGTCCCTC -3'

Sequencing Primer
(F):5'- AGAGGGTCTTTCACAACCTG -3'
(R):5'- CCTCCAGGGTGAGAAAAGAAGTCAC -3'
Posted On2015-03-25