Incidental Mutation 'R2090:Lsp1'
ID273632
Institutional Source Beutler Lab
Gene Symbol Lsp1
Ensembl Gene ENSMUSG00000018819
Gene Namelymphocyte specific 1
Synonymspp52, leukocyte specific protein 1, WP34, lymphocyte-specific protein 1, leukocyte-specific protein 1, Lsp-1, p50
MMRRC Submission 040095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2090 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location142460809-142494867 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 142491807 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018963] [ENSMUST00000038946] [ENSMUST00000105966] [ENSMUST00000105967] [ENSMUST00000105968] [ENSMUST00000140626] [ENSMUST00000149521]
Predicted Effect probably benign
Transcript: ENSMUST00000018963
SMART Domains Protein: ENSMUSP00000018963
Gene: ENSMUSG00000018819

DomainStartEndE-ValueType
coiled coil region 29 53 N/A INTRINSIC
Pfam:Caldesmon 173 303 2.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038946
SMART Domains Protein: ENSMUSP00000040637
Gene: ENSMUSG00000018819

DomainStartEndE-ValueType
coiled coil region 27 51 N/A INTRINSIC
Pfam:Caldesmon 171 301 2.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054910
SMART Domains Protein: ENSMUSP00000061994
Gene: ENSMUSG00000043795

DomainStartEndE-ValueType
Pfam:DUF4643 6 259 1.3e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105966
SMART Domains Protein: ENSMUSP00000101586
Gene: ENSMUSG00000018819

DomainStartEndE-ValueType
coiled coil region 27 51 N/A INTRINSIC
Pfam:Caldesmon 166 294 6.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105967
SMART Domains Protein: ENSMUSP00000101587
Gene: ENSMUSG00000018819

DomainStartEndE-ValueType
coiled coil region 29 53 N/A INTRINSIC
Pfam:Caldesmon 168 296 6.7e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105968
SMART Domains Protein: ENSMUSP00000101588
Gene: ENSMUSG00000018819

DomainStartEndE-ValueType
coiled coil region 29 53 N/A INTRINSIC
Pfam:Caldesmon 173 280 9.3e-29 PFAM
low complexity region 291 307 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128986
Predicted Effect probably benign
Transcript: ENSMUST00000140626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142408
Predicted Effect probably benign
Transcript: ENSMUST00000149521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151580
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular F-actin binding protein. The protein is expressed in lymphocytes, neutrophils, macrophages, and endothelium and may regulate neutrophil motility, adhesion to fibrinogen matrix proteins, and transendothelial migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased numbers of resident peritoneal macrophages and reduced numbers of peritoneal lymphocytes. Mutant neutrophils show abnormal morphology and impaired chemokine-induced migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,676 S283P probably benign Het
Adam32 A G 8: 24,901,440 probably null Het
Adcy7 A T 8: 88,315,857 T451S probably damaging Het
Adgrg3 A T 8: 95,039,930 T410S possibly damaging Het
Alg11 G T 8: 22,065,630 L302F possibly damaging Het
Ankrd17 A G 5: 90,298,046 V310A possibly damaging Het
Atg16l2 C T 7: 101,293,368 probably null Het
AY761184 A T 8: 21,702,789 W64R possibly damaging Het
B3gnt2 A G 11: 22,836,291 V299A probably benign Het
Birc6 A G 17: 74,662,796 N4258S probably benign Het
C2cd4d A G 3: 94,364,014 K196E probably benign Het
Cdr2l A G 11: 115,391,001 K111E probably damaging Het
Crtam T C 9: 40,984,316 Q41R possibly damaging Het
Cspp1 A G 1: 10,090,268 K560R possibly damaging Het
Dcaf15 A T 8: 84,097,771 Y571* probably null Het
Dpy19l4 T C 4: 11,304,344 Y99C probably benign Het
Edem3 C T 1: 151,804,826 probably benign Het
Enpp6 A T 8: 47,065,370 probably null Het
Fam26f A G 10: 34,126,362 S242P probably damaging Het
Foxf2 T A 13: 31,626,841 D254E probably benign Het
Gjb5 T C 4: 127,356,001 N117D probably benign Het
Glmn G A 5: 107,561,928 L337F probably damaging Het
Gsdmc2 T A 15: 63,826,826 Y307F probably benign Het
Gsdmc3 T A 15: 63,866,782 M144L probably benign Het
Ibtk A G 9: 85,720,993 I653T probably benign Het
Il24 T G 1: 130,884,837 D99A possibly damaging Het
Intu A G 3: 40,683,536 Q484R probably benign Het
Mad1l1 A G 5: 140,009,256 S672P probably benign Het
Man2a2 A T 7: 80,364,110 probably benign Het
Morc3 C A 16: 93,866,453 H515N probably benign Het
Nav1 T C 1: 135,607,165 probably benign Het
Ndor1 A G 2: 25,249,218 L247P probably damaging Het
Nfkbiz A T 16: 55,816,455 F494L probably benign Het
Nr1d1 G A 11: 98,770,610 P277S probably damaging Het
Nrg2 T C 18: 36,018,443 D682G probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Oasl1 G A 5: 114,935,934 D301N probably damaging Het
Olfr1118 A T 2: 87,309,418 I230F probably benign Het
Olfr196 A G 16: 59,168,140 M1T probably null Het
Olfr304 A T 7: 86,386,081 I193N probably benign Het
Palmd A G 3: 116,927,434 S123P probably damaging Het
Patj A G 4: 98,437,323 probably benign Het
Pcsk4 T C 10: 80,325,821 D162G probably benign Het
Plppr5 A G 3: 117,575,871 D59G possibly damaging Het
Pmvk A C 3: 89,461,882 R11S possibly damaging Het
Pnliprp1 A G 19: 58,740,469 T363A probably benign Het
Poll A T 19: 45,558,838 I65N probably benign Het
Prox1 T A 1: 190,160,812 S479C probably damaging Het
Prss50 A T 9: 110,862,293 S222C probably damaging Het
Rasa3 A C 8: 13,582,381 probably benign Het
Sec14l3 T C 11: 4,075,481 V335A probably benign Het
Setbp1 C T 18: 78,856,720 S1244N probably benign Het
Sgcg A T 14: 61,245,764 F63I probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc2a13 T A 15: 91,516,492 I176F probably benign Het
Smc6 A G 12: 11,289,986 T432A probably benign Het
Snx25 G A 8: 46,056,113 P478L probably damaging Het
Taf2 A T 15: 55,016,486 H1151Q probably damaging Het
Thsd1 A G 8: 22,259,657 K795R possibly damaging Het
Tmem108 G A 9: 103,484,777 L537F possibly damaging Het
Ubr3 T C 2: 69,936,017 Y410H probably damaging Het
Vav3 T C 3: 109,647,739 probably null Het
Vmn1r224 T C 17: 20,419,262 Y34H probably benign Het
Zeb1 T C 18: 5,766,458 V323A possibly damaging Het
Zfp652 A G 11: 95,754,008 D240G probably benign Het
Zfp963 A T 8: 69,743,346 C152* probably null Het
Other mutations in Lsp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02351:Lsp1 APN 7 142488942 critical splice donor site probably null
IGL02358:Lsp1 APN 7 142488942 critical splice donor site probably null
IGL02624:Lsp1 APN 7 142490551 splice site probably benign
R0594:Lsp1 UTSW 7 142488950 splice site probably benign
R0603:Lsp1 UTSW 7 142489378 missense probably damaging 1.00
R2055:Lsp1 UTSW 7 142489407 critical splice donor site probably null
R3911:Lsp1 UTSW 7 142486361 missense probably damaging 0.98
R5965:Lsp1 UTSW 7 142490424 critical splice donor site probably null
R7186:Lsp1 UTSW 7 142490352 missense probably damaging 1.00
R7216:Lsp1 UTSW 7 142488442 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTGATCTGTGTCTGTCCG -3'
(R):5'- TCACTGGCTGAGTCCCATAG -3'

Sequencing Primer
(F):5'- CGATAGGCTCTTCTTAGCAGCTAG -3'
(R):5'- TGGCTGAGTCCCATAGAGACC -3'
Posted On2015-03-30