Incidental Mutation 'R1757:Lama1'
ID 273634
Institutional Source Beutler Lab
Gene Symbol Lama1
Ensembl Gene ENSMUSG00000032796
Gene Name laminin, alpha 1
Synonyms Lama
MMRRC Submission 039789-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1757 (G1)
Quality Score 32
Status Validated
Chromosome 17
Chromosomal Location 68004254-68129642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 68004378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 17 (V17M)
Ref Sequence ENSEMBL: ENSMUSP00000043957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035471]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000035471
AA Change: V17M
SMART Domains Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: V17M

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
LamNT 23 275 1.2e-131 SMART
EGF_Lam 277 331 1e-5 SMART
EGF_Lam 334 401 6.6e-6 SMART
EGF_Lam 404 458 9.11e-9 SMART
EGF_Lam 461 507 8.12e-6 SMART
LamB 570 702 2.09e-57 SMART
EGF_like 715 746 3.36e0 SMART
EGF_Lam 749 795 7.01e-10 SMART
EGF_Lam 798 853 3.59e-7 SMART
EGF_Lam 856 906 1.53e-10 SMART
EGF_Lam 909 955 1.13e-13 SMART
EGF_Lam 958 1002 1.36e-7 SMART
EGF_Lam 1005 1048 7.29e-8 SMART
EGF_like 1034 1082 4.83e1 SMART
EGF_Lam 1051 1094 1.67e-7 SMART
EGF_Lam 1097 1154 1.32e-5 SMART
LamB 1220 1352 8.7e-46 SMART
Pfam:Laminin_EGF 1367 1397 1.7e-6 PFAM
EGF_Lam 1410 1456 7.12e-11 SMART
EGF_Lam 1459 1513 3.25e-5 SMART
EGF_like 1497 1547 6.41e1 SMART
EGF_Lam 1516 1560 1.71e-13 SMART
Pfam:Laminin_I 1574 1838 1.7e-91 PFAM
low complexity region 2012 2031 N/A INTRINSIC
low complexity region 2087 2098 N/A INTRINSIC
LamG 2145 2287 3.66e-30 SMART
LamG 2332 2473 5.98e-35 SMART
LamG 2513 2661 1.11e-29 SMART
low complexity region 2695 2708 N/A INTRINSIC
LamG 2743 2877 9.72e-35 SMART
LamG 2920 3056 4.63e-41 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 100% (111/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 A T 14: 8,049,867 (GRCm38) I219F probably damaging Het
Acvr1b A G 15: 101,096,703 (GRCm39) I207V possibly damaging Het
Adamtsl4 T C 3: 95,585,252 (GRCm39) T839A probably benign Het
Akap1 C T 11: 88,736,578 (GRCm39) R61H probably damaging Het
Akap9 A G 5: 4,051,667 (GRCm39) D1478G probably benign Het
Aloxe3 T A 11: 69,026,775 (GRCm39) V547E possibly damaging Het
Ano6 G A 15: 95,860,148 (GRCm39) A757T probably damaging Het
Armc10 A G 5: 21,858,455 (GRCm39) T167A probably damaging Het
BB019430 A C 10: 58,539,869 (GRCm39) noncoding transcript Het
Brms1 C T 19: 5,096,435 (GRCm39) R82W probably damaging Het
Btnl6 G A 17: 34,733,062 (GRCm39) T267I probably benign Het
Catsper4 A T 4: 133,945,212 (GRCm39) F215L probably benign Het
Ccdc188 T C 16: 18,036,552 (GRCm39) F197S probably damaging Het
Cers5 A C 15: 99,634,212 (GRCm39) C379G probably benign Het
Chchd6 A G 6: 89,361,626 (GRCm39) L259P probably damaging Het
Cntnap2 T A 6: 46,736,763 (GRCm39) C730S probably damaging Het
Coch T G 12: 51,649,631 (GRCm39) V314G probably damaging Het
Cog1 T A 11: 113,543,130 (GRCm39) S213T possibly damaging Het
Crot A T 5: 9,037,828 (GRCm39) F163I probably damaging Het
Cyp4f13 A T 17: 33,148,932 (GRCm39) I162N probably damaging Het
Dab2 A T 15: 6,359,933 (GRCm39) probably benign Het
Depdc1b C T 13: 108,460,482 (GRCm39) R31W probably damaging Het
Dlk1 T C 12: 109,425,613 (GRCm39) F161S probably damaging Het
Dnah6 T C 6: 73,137,965 (GRCm39) E913G probably damaging Het
Dnajc6 A G 4: 101,455,028 (GRCm39) Y5C probably damaging Het
Dock10 T C 1: 80,511,586 (GRCm39) T1508A probably damaging Het
Dstyk A G 1: 132,361,832 (GRCm39) probably benign Het
Efcc1 T C 6: 87,726,265 (GRCm39) probably benign Het
Entpd1 T C 19: 40,727,450 (GRCm39) Y533H probably benign Het
Epha8 A T 4: 136,658,789 (GRCm39) probably null Het
Erich3 C T 3: 154,401,402 (GRCm39) T17M probably damaging Het
Ethe1 T C 7: 24,307,899 (GRCm39) probably benign Het
Fbxw15 A T 9: 109,386,347 (GRCm39) M211K probably damaging Het
Fhod3 G A 18: 25,199,335 (GRCm39) V669M possibly damaging Het
Fktn C T 4: 53,747,003 (GRCm39) probably benign Het
Foxred1 G A 9: 35,122,130 (GRCm39) R20C probably benign Het
Gbp9 A G 5: 105,242,319 (GRCm39) L140P probably damaging Het
Gga1 T C 15: 78,773,230 (GRCm39) L286P probably damaging Het
Gml T C 15: 74,685,462 (GRCm39) probably benign Het
Gsap A T 5: 21,486,035 (GRCm39) K628N probably damaging Het
Gtf3c4 G A 2: 28,720,648 (GRCm39) probably benign Het
H2-M10.6 A C 17: 37,124,043 (GRCm39) Y169S probably benign Het
Hal G A 10: 93,330,490 (GRCm39) V245I probably benign Het
Hebp2 T C 10: 18,420,849 (GRCm39) Y72C probably damaging Het
Helz2 T C 2: 180,878,056 (GRCm39) E914G probably damaging Het
Herc3 T C 6: 58,893,455 (GRCm39) Y906H probably damaging Het
Hfm1 A T 5: 107,028,226 (GRCm39) probably null Het
Hgs C T 11: 120,370,889 (GRCm39) P582S probably damaging Het
Hoxa10 G A 6: 52,211,469 (GRCm39) P149L probably damaging Het
Inpp5j T A 11: 3,454,738 (GRCm39) Q4L possibly damaging Het
Ints8 A C 4: 11,254,109 (GRCm39) M1R probably null Het
Isg15 T C 4: 156,284,447 (GRCm39) E27G possibly damaging Het
Klf13 A T 7: 63,541,513 (GRCm39) C205S probably damaging Het
Lama3 A G 18: 12,598,556 (GRCm39) N988D probably benign Het
Lcat CAT C 8: 106,668,446 (GRCm39) probably null Het
Lct G T 1: 128,228,994 (GRCm39) P833H probably damaging Het
Lmf1 A T 17: 25,874,184 (GRCm39) R403W probably damaging Het
Me3 T G 7: 89,282,230 (GRCm39) S38A probably benign Het
Myg1 A T 15: 102,240,264 (GRCm39) D30V probably benign Het
Nbea A G 3: 55,537,610 (GRCm39) I2841T possibly damaging Het
Nek1 T A 8: 61,542,847 (GRCm39) probably null Het
Obsl1 C T 1: 75,470,527 (GRCm39) R1043H probably benign Het
Or4p23 G T 2: 88,576,361 (GRCm39) D290E probably benign Het
Or5b119 A C 19: 13,456,971 (GRCm39) V197G possibly damaging Het
Or6n2 A T 1: 173,897,224 (GRCm39) Y120F probably damaging Het
Or9m2 T G 2: 87,820,926 (GRCm39) I157R probably damaging Het
Osbpl9 A G 4: 108,921,780 (GRCm39) Y613H probably damaging Het
Per3 C T 4: 151,127,249 (GRCm39) probably null Het
Pex6 G T 17: 47,034,424 (GRCm39) V758L probably damaging Het
Pikfyve A G 1: 65,291,707 (GRCm39) I1309V probably damaging Het
Pimreg A G 11: 71,933,985 (GRCm39) E37G possibly damaging Het
Pjvk G A 2: 76,486,232 (GRCm39) V211I probably benign Het
Plekhg4 T A 8: 106,108,293 (GRCm39) V1112E probably damaging Het
Ptprz1 T A 6: 23,044,319 (GRCm39) M2106K probably damaging Het
Rdh16f2 G T 10: 127,712,765 (GRCm39) L254F probably benign Het
Rictor G A 15: 6,803,343 (GRCm39) R485Q possibly damaging Het
Rnf146 G A 10: 29,223,475 (GRCm39) T137M probably damaging Het
Rrp9 T A 9: 106,360,203 (GRCm39) C204S probably damaging Het
Rxylt1 T C 10: 121,924,920 (GRCm39) T261A probably benign Het
Serpinb9h T C 13: 33,583,336 (GRCm39) S150P probably benign Het
Shkbp1 T C 7: 27,041,776 (GRCm39) T693A probably benign Het
Skint9 A G 4: 112,271,159 (GRCm39) Y84H probably benign Het
Slc22a12 A T 19: 6,586,761 (GRCm39) probably null Het
Slfn4 T C 11: 83,076,211 (GRCm39) C26R possibly damaging Het
Snrnp200 T C 2: 127,074,363 (GRCm39) L1401P probably damaging Het
Specc1 T A 11: 62,010,110 (GRCm39) probably null Het
Spef2 A T 15: 9,717,568 (GRCm39) M316K probably damaging Het
Tbc1d22b A G 17: 29,790,647 (GRCm39) R204G probably damaging Het
Tektl1 T C 10: 78,583,058 (GRCm39) N442S probably benign Het
Tgfbr3l C A 8: 4,299,548 (GRCm39) D110E probably benign Het
Ticrr T G 7: 79,325,071 (GRCm39) S532R probably damaging Het
Ticrr C A 7: 79,328,794 (GRCm39) Y644* probably null Het
Traf3ip1 A T 1: 91,450,579 (GRCm39) T509S probably damaging Het
Trmt10b T C 4: 45,307,946 (GRCm39) Y209H probably damaging Het
Trmt6 T C 2: 132,652,157 (GRCm39) M172V probably damaging Het
Tsc1 A G 2: 28,576,125 (GRCm39) D978G probably benign Het
Tshz2 C A 2: 169,725,843 (GRCm39) F146L probably benign Het
Tspyl4 G T 10: 34,173,576 (GRCm39) E23* probably null Het
Ulk2 A T 11: 61,732,165 (GRCm39) probably benign Het
Umodl1 A T 17: 31,227,674 (GRCm39) I1336F probably damaging Het
Vezt T C 10: 93,806,425 (GRCm39) D662G probably benign Het
Vnn1 G T 10: 23,776,727 (GRCm39) Q359H probably benign Het
Vnn1 A T 10: 23,776,726 (GRCm39) Q359L possibly damaging Het
Zdhhc16 A G 19: 41,930,394 (GRCm39) N14S probably damaging Het
Zfp455 T C 13: 67,355,601 (GRCm39) S225P probably damaging Het
Zfp74 T A 7: 29,634,486 (GRCm39) E407D probably benign Het
Zic2 T A 14: 122,716,031 (GRCm39) H384Q possibly damaging Het
Other mutations in Lama1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Lama1 APN 17 68,122,923 (GRCm39) missense probably benign
IGL00336:Lama1 APN 17 68,120,943 (GRCm39) missense probably benign 0.07
IGL01066:Lama1 APN 17 68,050,321 (GRCm39) missense probably damaging 1.00
IGL01140:Lama1 APN 17 68,109,928 (GRCm39) missense probably benign 0.14
IGL01291:Lama1 APN 17 68,045,865 (GRCm39) missense probably damaging 1.00
IGL01296:Lama1 APN 17 68,052,046 (GRCm39) missense probably benign 0.27
IGL01317:Lama1 APN 17 68,125,696 (GRCm39) missense probably damaging 1.00
IGL01490:Lama1 APN 17 68,057,579 (GRCm39) missense possibly damaging 0.54
IGL01506:Lama1 APN 17 68,092,065 (GRCm39) missense probably benign 0.01
IGL01508:Lama1 APN 17 68,116,356 (GRCm39) splice site probably benign
IGL01522:Lama1 APN 17 68,059,769 (GRCm39) splice site probably benign
IGL01530:Lama1 APN 17 68,103,785 (GRCm39) missense probably benign 0.02
IGL01541:Lama1 APN 17 68,092,065 (GRCm39) missense probably benign 0.01
IGL01677:Lama1 APN 17 68,086,143 (GRCm39) missense probably benign 0.15
IGL01886:Lama1 APN 17 68,114,792 (GRCm39) missense probably benign 0.36
IGL01994:Lama1 APN 17 68,059,434 (GRCm39) missense probably benign 0.05
IGL02017:Lama1 APN 17 68,071,720 (GRCm39) missense probably benign 0.00
IGL02021:Lama1 APN 17 68,128,621 (GRCm39) missense probably damaging 1.00
IGL02026:Lama1 APN 17 68,116,287 (GRCm39) missense possibly damaging 0.82
IGL02044:Lama1 APN 17 68,118,485 (GRCm39) missense probably benign 0.01
IGL02120:Lama1 APN 17 68,023,784 (GRCm39) missense probably damaging 1.00
IGL02425:Lama1 APN 17 68,118,480 (GRCm39) missense probably benign 0.45
IGL02549:Lama1 APN 17 68,097,830 (GRCm39) missense possibly damaging 0.93
IGL02642:Lama1 APN 17 68,119,361 (GRCm39) missense probably benign 0.00
IGL02795:Lama1 APN 17 68,045,889 (GRCm39) splice site probably null
IGL02798:Lama1 APN 17 68,102,186 (GRCm39) splice site probably benign
IGL02863:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02870:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02876:Lama1 APN 17 68,057,687 (GRCm39) critical splice donor site probably null
IGL02885:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02891:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02978:Lama1 APN 17 68,093,076 (GRCm39) nonsense probably null
IGL03064:Lama1 APN 17 68,086,099 (GRCm39) missense probably benign 0.01
IGL03076:Lama1 APN 17 68,023,794 (GRCm39) missense possibly damaging 0.95
IGL03110:Lama1 APN 17 68,105,981 (GRCm39) missense probably benign 0.04
IGL03143:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL03159:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL03268:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
ANU05:Lama1 UTSW 17 68,045,865 (GRCm39) missense probably damaging 1.00
PIT4472001:Lama1 UTSW 17 68,071,699 (GRCm39) missense
R0047:Lama1 UTSW 17 68,102,181 (GRCm39) splice site probably benign
R0047:Lama1 UTSW 17 68,102,181 (GRCm39) splice site probably benign
R0050:Lama1 UTSW 17 68,089,051 (GRCm39) missense possibly damaging 0.66
R0096:Lama1 UTSW 17 68,112,408 (GRCm39) missense probably benign 0.12
R0096:Lama1 UTSW 17 68,112,408 (GRCm39) missense probably benign 0.12
R0111:Lama1 UTSW 17 68,044,493 (GRCm39) missense probably damaging 0.98
R0116:Lama1 UTSW 17 68,083,918 (GRCm39) missense probably benign 0.10
R0121:Lama1 UTSW 17 68,105,508 (GRCm39) splice site probably benign
R0278:Lama1 UTSW 17 68,117,178 (GRCm39) missense probably null 0.98
R0281:Lama1 UTSW 17 68,124,564 (GRCm39) missense probably damaging 1.00
R0312:Lama1 UTSW 17 68,082,846 (GRCm39) missense possibly damaging 0.45
R0419:Lama1 UTSW 17 68,098,605 (GRCm39) critical splice donor site probably null
R0512:Lama1 UTSW 17 68,086,129 (GRCm39) missense possibly damaging 0.67
R0514:Lama1 UTSW 17 68,071,693 (GRCm39) missense probably benign 0.40
R0562:Lama1 UTSW 17 68,122,954 (GRCm39) missense probably damaging 1.00
R0632:Lama1 UTSW 17 68,059,363 (GRCm39) splice site probably benign
R0645:Lama1 UTSW 17 68,080,707 (GRCm39) missense probably benign 0.01
R0712:Lama1 UTSW 17 68,086,037 (GRCm39) splice site probably null
R0763:Lama1 UTSW 17 68,079,813 (GRCm39) missense probably damaging 0.97
R0941:Lama1 UTSW 17 68,082,860 (GRCm39) missense probably benign 0.10
R1025:Lama1 UTSW 17 68,059,893 (GRCm39) missense probably benign 0.00
R1084:Lama1 UTSW 17 68,111,464 (GRCm39) missense probably benign 0.12
R1103:Lama1 UTSW 17 68,097,942 (GRCm39) missense probably damaging 0.98
R1420:Lama1 UTSW 17 68,097,942 (GRCm39) missense probably damaging 0.98
R1430:Lama1 UTSW 17 68,089,150 (GRCm39) missense possibly damaging 0.95
R1569:Lama1 UTSW 17 68,087,613 (GRCm39) splice site probably null
R1575:Lama1 UTSW 17 68,117,404 (GRCm39) missense possibly damaging 0.96
R1613:Lama1 UTSW 17 68,114,918 (GRCm39) missense probably benign 0.42
R1620:Lama1 UTSW 17 68,074,028 (GRCm39) missense probably benign 0.01
R1629:Lama1 UTSW 17 68,112,423 (GRCm39) missense probably benign 0.00
R1645:Lama1 UTSW 17 68,044,677 (GRCm39) missense probably benign 0.14
R1652:Lama1 UTSW 17 68,114,841 (GRCm39) missense probably damaging 0.97
R1674:Lama1 UTSW 17 68,098,239 (GRCm39) missense probably benign
R1678:Lama1 UTSW 17 68,117,150 (GRCm39) missense possibly damaging 0.56
R1710:Lama1 UTSW 17 68,060,786 (GRCm39) missense probably benign 0.00
R1712:Lama1 UTSW 17 68,024,181 (GRCm39) missense possibly damaging 0.95
R1737:Lama1 UTSW 17 68,109,916 (GRCm39) missense probably benign 0.36
R1757:Lama1 UTSW 17 68,070,831 (GRCm39) missense probably benign 0.40
R1813:Lama1 UTSW 17 68,098,218 (GRCm39) missense probably benign
R1896:Lama1 UTSW 17 68,098,218 (GRCm39) missense probably benign
R1945:Lama1 UTSW 17 68,052,848 (GRCm39) missense probably benign 0.14
R2086:Lama1 UTSW 17 68,124,618 (GRCm39) missense probably damaging 1.00
R2149:Lama1 UTSW 17 68,080,860 (GRCm39) missense possibly damaging 0.95
R2178:Lama1 UTSW 17 68,076,510 (GRCm39) missense probably benign 0.07
R2183:Lama1 UTSW 17 68,098,004 (GRCm39) missense probably damaging 0.98
R2197:Lama1 UTSW 17 68,059,936 (GRCm39) missense probably benign 0.02
R2213:Lama1 UTSW 17 68,084,029 (GRCm39) nonsense probably null
R2260:Lama1 UTSW 17 68,044,502 (GRCm39) missense probably damaging 0.96
R2356:Lama1 UTSW 17 68,117,109 (GRCm39) missense probably damaging 1.00
R2420:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2421:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2422:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2424:Lama1 UTSW 17 68,105,660 (GRCm39) missense probably benign 0.09
R2442:Lama1 UTSW 17 68,075,312 (GRCm39) missense probably benign 0.04
R3147:Lama1 UTSW 17 68,044,653 (GRCm39) missense probably damaging 0.98
R3414:Lama1 UTSW 17 68,044,598 (GRCm39) missense probably damaging 1.00
R3683:Lama1 UTSW 17 68,075,328 (GRCm39) missense probably benign 0.40
R3820:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R3821:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R3822:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R4012:Lama1 UTSW 17 68,119,368 (GRCm39) nonsense probably null
R4113:Lama1 UTSW 17 68,071,698 (GRCm39) missense probably benign 0.01
R4133:Lama1 UTSW 17 68,119,481 (GRCm39) missense probably damaging 1.00
R4133:Lama1 UTSW 17 68,057,650 (GRCm39) missense probably damaging 0.98
R4259:Lama1 UTSW 17 68,059,413 (GRCm39) missense possibly damaging 0.95
R4278:Lama1 UTSW 17 68,098,512 (GRCm39) missense probably null 0.00
R4321:Lama1 UTSW 17 68,078,078 (GRCm39) missense probably benign 0.03
R4374:Lama1 UTSW 17 68,111,513 (GRCm39) missense probably benign 0.00
R4386:Lama1 UTSW 17 68,080,707 (GRCm39) missense probably benign 0.01
R4463:Lama1 UTSW 17 68,068,695 (GRCm39) missense probably damaging 1.00
R4629:Lama1 UTSW 17 68,112,355 (GRCm39) critical splice acceptor site probably null
R4630:Lama1 UTSW 17 68,101,295 (GRCm39) missense probably benign 0.00
R4633:Lama1 UTSW 17 68,105,579 (GRCm39) missense probably damaging 0.96
R4668:Lama1 UTSW 17 68,059,429 (GRCm39) missense probably benign 0.27
R4684:Lama1 UTSW 17 68,080,773 (GRCm39) missense possibly damaging 0.88
R4745:Lama1 UTSW 17 68,045,775 (GRCm39) missense probably damaging 1.00
R4786:Lama1 UTSW 17 68,080,854 (GRCm39) missense possibly damaging 0.77
R4797:Lama1 UTSW 17 68,023,770 (GRCm39) missense probably benign 0.04
R4803:Lama1 UTSW 17 68,116,266 (GRCm39) missense probably damaging 1.00
R4925:Lama1 UTSW 17 68,101,309 (GRCm39) missense probably benign 0.02
R4939:Lama1 UTSW 17 68,044,470 (GRCm39) missense possibly damaging 0.91
R4952:Lama1 UTSW 17 68,074,561 (GRCm39) critical splice donor site probably null
R4975:Lama1 UTSW 17 68,045,829 (GRCm39) missense possibly damaging 0.95
R4977:Lama1 UTSW 17 68,044,677 (GRCm39) missense probably damaging 1.00
R5039:Lama1 UTSW 17 68,052,888 (GRCm39) missense possibly damaging 0.66
R5047:Lama1 UTSW 17 68,050,276 (GRCm39) nonsense probably null
R5195:Lama1 UTSW 17 68,071,795 (GRCm39) missense probably benign 0.13
R5230:Lama1 UTSW 17 68,052,078 (GRCm39) nonsense probably null
R5236:Lama1 UTSW 17 68,111,487 (GRCm39) missense probably benign 0.24
R5254:Lama1 UTSW 17 68,063,711 (GRCm39) missense probably benign 0.01
R5345:Lama1 UTSW 17 68,124,558 (GRCm39) missense probably benign
R5438:Lama1 UTSW 17 68,107,769 (GRCm39) missense possibly damaging 0.92
R5521:Lama1 UTSW 17 68,087,889 (GRCm39) nonsense probably null
R5568:Lama1 UTSW 17 68,075,293 (GRCm39) critical splice acceptor site probably null
R5645:Lama1 UTSW 17 68,109,943 (GRCm39) missense probably damaging 1.00
R5665:Lama1 UTSW 17 68,077,982 (GRCm39) missense probably damaging 1.00
R5727:Lama1 UTSW 17 68,122,219 (GRCm39) missense possibly damaging 0.81
R5757:Lama1 UTSW 17 68,045,782 (GRCm39) missense possibly damaging 0.59
R5795:Lama1 UTSW 17 68,103,722 (GRCm39) missense probably benign 0.02
R5857:Lama1 UTSW 17 68,114,838 (GRCm39) missense probably damaging 0.99
R5894:Lama1 UTSW 17 68,086,042 (GRCm39) critical splice acceptor site probably null
R5974:Lama1 UTSW 17 68,080,722 (GRCm39) missense probably benign 0.31
R6032:Lama1 UTSW 17 68,057,638 (GRCm39) missense probably benign 0.01
R6032:Lama1 UTSW 17 68,057,638 (GRCm39) missense probably benign 0.01
R6120:Lama1 UTSW 17 68,087,612 (GRCm39) critical splice donor site probably null
R6219:Lama1 UTSW 17 68,097,851 (GRCm39) missense probably benign 0.08
R6224:Lama1 UTSW 17 68,109,982 (GRCm39) missense possibly damaging 0.56
R6249:Lama1 UTSW 17 68,105,599 (GRCm39) missense probably benign
R6265:Lama1 UTSW 17 68,057,650 (GRCm39) missense probably damaging 0.98
R6276:Lama1 UTSW 17 68,091,083 (GRCm39) splice site probably null
R6284:Lama1 UTSW 17 68,117,091 (GRCm39) missense probably damaging 0.99
R6337:Lama1 UTSW 17 68,093,014 (GRCm39) missense probably benign 0.27
R6414:Lama1 UTSW 17 68,053,905 (GRCm39) critical splice donor site probably null
R6631:Lama1 UTSW 17 68,081,477 (GRCm39) missense probably benign 0.21
R6659:Lama1 UTSW 17 68,125,630 (GRCm39) missense probably damaging 1.00
R6660:Lama1 UTSW 17 68,111,495 (GRCm39) missense probably benign 0.05
R6677:Lama1 UTSW 17 68,102,228 (GRCm39) missense probably benign 0.14
R6763:Lama1 UTSW 17 68,053,868 (GRCm39) missense unknown
R6787:Lama1 UTSW 17 68,091,020 (GRCm39) missense unknown
R6831:Lama1 UTSW 17 68,063,749 (GRCm39) missense possibly damaging 0.89
R6855:Lama1 UTSW 17 68,089,150 (GRCm39) missense possibly damaging 0.95
R6910:Lama1 UTSW 17 68,098,459 (GRCm39) missense possibly damaging 0.60
R6934:Lama1 UTSW 17 68,081,538 (GRCm39) missense probably benign 0.04
R6945:Lama1 UTSW 17 68,120,861 (GRCm39) missense
R6984:Lama1 UTSW 17 68,086,107 (GRCm39) missense
R6989:Lama1 UTSW 17 68,060,753 (GRCm39) missense
R6994:Lama1 UTSW 17 68,060,820 (GRCm39) missense
R6995:Lama1 UTSW 17 68,060,820 (GRCm39) missense
R7035:Lama1 UTSW 17 68,088,044 (GRCm39) missense
R7133:Lama1 UTSW 17 68,089,141 (GRCm39) missense
R7172:Lama1 UTSW 17 68,111,540 (GRCm39) missense
R7197:Lama1 UTSW 17 68,044,700 (GRCm39) nonsense probably null
R7217:Lama1 UTSW 17 68,071,668 (GRCm39) missense
R7229:Lama1 UTSW 17 68,059,441 (GRCm39) missense
R7264:Lama1 UTSW 17 68,050,292 (GRCm39) missense
R7311:Lama1 UTSW 17 68,074,380 (GRCm39) missense
R7394:Lama1 UTSW 17 68,024,256 (GRCm39) missense
R7419:Lama1 UTSW 17 68,024,169 (GRCm39) missense
R7460:Lama1 UTSW 17 68,074,013 (GRCm39) missense
R7492:Lama1 UTSW 17 68,124,646 (GRCm39) missense
R7494:Lama1 UTSW 17 68,118,441 (GRCm39) missense
R7552:Lama1 UTSW 17 68,044,662 (GRCm39) missense
R7576:Lama1 UTSW 17 68,089,036 (GRCm39) missense
R7583:Lama1 UTSW 17 68,068,616 (GRCm39) missense
R7649:Lama1 UTSW 17 68,044,549 (GRCm39) missense
R7663:Lama1 UTSW 17 68,087,875 (GRCm39) missense
R7667:Lama1 UTSW 17 68,087,592 (GRCm39) missense
R7688:Lama1 UTSW 17 68,068,623 (GRCm39) missense
R7693:Lama1 UTSW 17 68,124,026 (GRCm39) missense
R7748:Lama1 UTSW 17 68,057,585 (GRCm39) missense
R7778:Lama1 UTSW 17 68,111,468 (GRCm39) missense
R7824:Lama1 UTSW 17 68,111,468 (GRCm39) missense
R7861:Lama1 UTSW 17 68,116,216 (GRCm39) missense
R7884:Lama1 UTSW 17 68,076,430 (GRCm39) missense
R8029:Lama1 UTSW 17 68,124,589 (GRCm39) missense
R8078:Lama1 UTSW 17 68,098,289 (GRCm39) missense
R8101:Lama1 UTSW 17 68,052,917 (GRCm39) missense
R8313:Lama1 UTSW 17 68,057,515 (GRCm39) missense
R8356:Lama1 UTSW 17 68,044,491 (GRCm39) missense
R8366:Lama1 UTSW 17 68,125,699 (GRCm39) missense
R8403:Lama1 UTSW 17 68,052,918 (GRCm39) missense
R8456:Lama1 UTSW 17 68,044,491 (GRCm39) missense
R8466:Lama1 UTSW 17 68,120,948 (GRCm39) missense
R8678:Lama1 UTSW 17 68,124,098 (GRCm39) missense
R8728:Lama1 UTSW 17 68,125,663 (GRCm39) missense
R8796:Lama1 UTSW 17 68,117,146 (GRCm39) missense
R8885:Lama1 UTSW 17 68,080,779 (GRCm39) missense
R8893:Lama1 UTSW 17 68,112,367 (GRCm39) missense
R8898:Lama1 UTSW 17 68,128,610 (GRCm39) missense
R8909:Lama1 UTSW 17 68,079,736 (GRCm39) missense
R9025:Lama1 UTSW 17 68,119,491 (GRCm39) missense
R9045:Lama1 UTSW 17 68,060,838 (GRCm39) missense
R9098:Lama1 UTSW 17 68,111,508 (GRCm39) missense
R9114:Lama1 UTSW 17 68,128,669 (GRCm39) missense
R9173:Lama1 UTSW 17 68,076,597 (GRCm39) missense
R9190:Lama1 UTSW 17 68,111,514 (GRCm39) missense
R9381:Lama1 UTSW 17 68,044,479 (GRCm39) missense
R9429:Lama1 UTSW 17 68,118,449 (GRCm39) missense
R9504:Lama1 UTSW 17 68,128,661 (GRCm39) missense
R9558:Lama1 UTSW 17 68,124,004 (GRCm39) missense
R9647:Lama1 UTSW 17 68,024,170 (GRCm39) missense
R9651:Lama1 UTSW 17 68,101,215 (GRCm39) missense
R9654:Lama1 UTSW 17 68,101,266 (GRCm39) missense
R9710:Lama1 UTSW 17 68,129,404 (GRCm39) missense
R9733:Lama1 UTSW 17 68,116,940 (GRCm39) missense
RF001:Lama1 UTSW 17 68,059,897 (GRCm39) missense
RF013:Lama1 UTSW 17 68,088,057 (GRCm39) missense
V8831:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
X0024:Lama1 UTSW 17 68,045,883 (GRCm39) missense probably damaging 1.00
X0028:Lama1 UTSW 17 68,101,305 (GRCm39) missense probably benign 0.06
X0028:Lama1 UTSW 17 68,074,417 (GRCm39) missense probably benign 0.00
X0066:Lama1 UTSW 17 68,118,561 (GRCm39) missense probably damaging 1.00
Z1088:Lama1 UTSW 17 68,117,166 (GRCm39) missense probably damaging 1.00
Z1088:Lama1 UTSW 17 68,078,077 (GRCm39) missense probably benign 0.25
Z1088:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1176:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1177:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1191:Lama1 UTSW 17 68,105,639 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGAACAGATCCCCTTGGGAAGAGAC -3'
(R):5'- CCCACTAAGCTAGAAAGCAGGTGAC -3'

Sequencing Primer
(F):5'- TAGGAAGGACTCCGCACG -3'
(R):5'- AAGCAGGTGACCCCTAGAGTC -3'
Posted On 2015-03-31