Incidental Mutation 'R3498:Gpr35'
ID 273638
Institutional Source Beutler Lab
Gene Symbol Gpr35
Ensembl Gene ENSMUSG00000026271
Gene Name G protein-coupled receptor 35
Synonyms
MMRRC Submission 040661-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3498 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 92878587-92914113 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92911113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 275 (Y275C)
Ref Sequence ENSEMBL: ENSMUSP00000139648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027489] [ENSMUST00000064480] [ENSMUST00000169198] [ENSMUST00000185421] [ENSMUST00000186298] [ENSMUST00000189697]
AlphaFold Q9ES90
Predicted Effect probably damaging
Transcript: ENSMUST00000027489
AA Change: Y59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027489
Gene: ENSMUSG00000026271
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 289 3.5e-7 PFAM
Pfam:7tm_1 34 275 1.8e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064480
AA Change: Y275C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070832
Gene: ENSMUSG00000026271
AA Change: Y275C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 289 3.5e-7 PFAM
Pfam:7tm_1 34 275 3.6e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169198
AA Change: Y275C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126914
Gene: ENSMUSG00000026271
AA Change: Y275C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 289 3.5e-7 PFAM
Pfam:7tm_1 34 275 3.6e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185421
Predicted Effect probably damaging
Transcript: ENSMUST00000186298
AA Change: Y275C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139648
Gene: ENSMUSG00000026271
AA Change: Y275C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 289 3.5e-7 PFAM
Pfam:7tm_1 34 275 3.6e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189697
SMART Domains Protein: ENSMUSP00000139787
Gene: ENSMUSG00000026271

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 147 5.7e-6 PFAM
Pfam:7tm_1 34 147 1.4e-24 PFAM
Meta Mutation Damage Score 0.8052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,649,350 (GRCm39) F6L probably benign Het
Aurkc A G 7: 7,003,029 (GRCm39) I175V probably damaging Het
Azi2 A G 9: 117,878,475 (GRCm39) D105G probably damaging Het
Bcat1 A G 6: 144,965,068 (GRCm39) V45A probably damaging Het
Cass4 C T 2: 172,274,478 (GRCm39) P753L probably damaging Het
Cimip3 AC A 17: 47,744,348 (GRCm39) probably benign Het
Ddx42 A G 11: 106,122,019 (GRCm39) E178G possibly damaging Het
Dmpk T C 7: 18,820,306 (GRCm39) I101T probably damaging Het
Dnah17 C T 11: 117,971,675 (GRCm39) probably benign Het
Fosb C T 7: 19,040,557 (GRCm39) R161H probably damaging Het
Gm6729 T C 10: 86,376,582 (GRCm39) noncoding transcript Het
Gnb1 T A 4: 155,639,483 (GRCm39) N237K possibly damaging Het
Hmcn1 A T 1: 150,480,853 (GRCm39) I4441N probably damaging Het
Ighe G A 12: 113,234,994 (GRCm39) Q389* probably null Het
Kcnj11 T C 7: 45,749,026 (GRCm39) D23G probably damaging Het
Lats2 G T 14: 57,959,923 (GRCm39) A191E possibly damaging Het
Lyplal1 A G 1: 185,820,857 (GRCm39) S197P possibly damaging Het
Map4 G T 9: 109,864,280 (GRCm39) V502L probably benign Het
Mgat5 A G 1: 127,312,571 (GRCm39) M237V possibly damaging Het
Mindy4 A G 6: 55,193,510 (GRCm39) R68G probably benign Het
Nell1 T A 7: 49,907,927 (GRCm39) V362E possibly damaging Het
Or5m8 T A 2: 85,822,774 (GRCm39) F204L probably benign Het
Or6c66b T A 10: 129,376,778 (GRCm39) I124N probably damaging Het
P4ha2 T C 11: 54,010,079 (GRCm39) Y279H probably benign Het
Pcid2 A G 8: 13,150,413 (GRCm39) V13A possibly damaging Het
Polr2j T C 5: 136,151,624 (GRCm39) I116T probably benign Het
Prdm9 A G 17: 15,783,207 (GRCm39) probably benign Het
Prr5 T A 15: 84,587,345 (GRCm39) V365E probably benign Het
Ptprf A T 4: 118,082,127 (GRCm39) I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,169,203 (GRCm39) probably benign Het
Sde2 T A 1: 180,685,750 (GRCm39) C101S probably damaging Het
Sec1 T C 7: 45,328,663 (GRCm39) H128R probably damaging Het
Serpinb6a A T 13: 34,102,764 (GRCm39) M253K probably damaging Het
Slc1a4 A T 11: 20,263,973 (GRCm39) I248N probably damaging Het
Slc22a4 T G 11: 53,882,879 (GRCm39) K328N probably benign Het
Slc24a4 A T 12: 102,200,951 (GRCm39) K278N probably benign Het
Slc6a21 T A 7: 44,930,266 (GRCm39) W222R probably damaging Het
Slc7a2 A G 8: 41,365,567 (GRCm39) E466G probably benign Het
Sspo A G 6: 48,444,914 (GRCm39) T2133A possibly damaging Het
Taco1 A G 11: 105,963,364 (GRCm39) M172V probably benign Het
Tmem127 T A 2: 127,098,040 (GRCm39) H36Q probably benign Het
Tmem229b-ps C T 10: 53,351,223 (GRCm39) noncoding transcript Het
Vac14 A G 8: 111,397,722 (GRCm39) D479G probably benign Het
Vmn1r176 T A 7: 23,534,667 (GRCm39) K162I probably benign Het
Other mutations in Gpr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Gpr35 APN 1 92,910,594 (GRCm39) missense probably damaging 0.99
IGL03102:Gpr35 APN 1 92,910,299 (GRCm39) missense probably benign 0.00
PIT4280001:Gpr35 UTSW 1 92,910,356 (GRCm39) missense probably damaging 1.00
R0015:Gpr35 UTSW 1 92,910,954 (GRCm39) missense probably damaging 1.00
R0412:Gpr35 UTSW 1 92,910,506 (GRCm39) missense probably benign 0.01
R1203:Gpr35 UTSW 1 92,910,870 (GRCm39) missense probably damaging 0.98
R1515:Gpr35 UTSW 1 92,910,770 (GRCm39) missense probably damaging 1.00
R2872:Gpr35 UTSW 1 92,910,848 (GRCm39) missense probably benign 0.34
R2872:Gpr35 UTSW 1 92,910,848 (GRCm39) missense probably benign 0.34
R3499:Gpr35 UTSW 1 92,911,113 (GRCm39) missense probably damaging 1.00
R4732:Gpr35 UTSW 1 92,911,107 (GRCm39) missense probably damaging 1.00
R4733:Gpr35 UTSW 1 92,911,107 (GRCm39) missense probably damaging 1.00
R5270:Gpr35 UTSW 1 92,910,299 (GRCm39) missense probably benign 0.00
R5969:Gpr35 UTSW 1 92,910,942 (GRCm39) missense probably damaging 1.00
R6769:Gpr35 UTSW 1 92,910,426 (GRCm39) missense probably damaging 0.97
R6771:Gpr35 UTSW 1 92,910,426 (GRCm39) missense probably damaging 0.97
R7144:Gpr35 UTSW 1 92,910,353 (GRCm39) missense probably benign 0.11
R7395:Gpr35 UTSW 1 92,910,929 (GRCm39) missense probably damaging 1.00
R8156:Gpr35 UTSW 1 92,910,437 (GRCm39) missense probably damaging 1.00
Z1177:Gpr35 UTSW 1 92,910,738 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGGTCTGGGCCAACTTG -3'
(R):5'- AGATGCAGCCTCTCTAGTCCAAC -3'

Sequencing Primer
(F):5'- CAACTTGGCTGTGTTTGTCATC -3'
(R):5'- TAGTCCAACTGGGTCTCCTAGAG -3'
Posted On 2015-04-02