Incidental Mutation 'R3498:Mgat5'
ID273639
Institutional Source Beutler Lab
Gene Symbol Mgat5
Ensembl Gene ENSMUSG00000036155
Gene Namemannoside acetylglucosaminyltransferase 5
Synonyms4930471A21Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV, 5330407H02Rik
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location127205015-127488336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127384834 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 237 (M237V)
Ref Sequence ENSEMBL: ENSMUSP00000129166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038361
AA Change: M237V

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: M237V

DomainStartEndE-ValueType
Pfam:DUF4525 2 138 3.4e-70 PFAM
Pfam:Glyco_transf_18 171 725 9.8e-268 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171405
AA Change: M237V

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: M237V

DomainStartEndE-ValueType
Pfam:DUF4525 3 137 9.3e-64 PFAM
Pfam:Glyco_transf_18 171 725 1.9e-268 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190921
Meta Mutation Damage Score 0.3132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Mgat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Mgat5 APN 1 127387467 missense probably damaging 1.00
IGL00813:Mgat5 APN 1 127384806 missense probably benign
IGL01795:Mgat5 APN 1 127469231 missense probably damaging 0.98
IGL01830:Mgat5 APN 1 127412132 missense probably damaging 1.00
IGL01879:Mgat5 APN 1 127397550 missense probably damaging 0.99
IGL02322:Mgat5 APN 1 127382985 missense probably benign 0.00
IGL02621:Mgat5 APN 1 127397589 missense possibly damaging 0.86
IGL02695:Mgat5 APN 1 127412131 missense probably damaging 1.00
IGL03142:Mgat5 APN 1 127412223 missense probably damaging 1.00
R0518:Mgat5 UTSW 1 127384847 missense probably damaging 1.00
R0594:Mgat5 UTSW 1 127412248 missense probably damaging 0.96
R1480:Mgat5 UTSW 1 127459979 missense probably damaging 1.00
R1501:Mgat5 UTSW 1 127397641 critical splice donor site probably null
R1712:Mgat5 UTSW 1 127320638 missense probably benign 0.34
R1744:Mgat5 UTSW 1 127479469 missense probably damaging 1.00
R1862:Mgat5 UTSW 1 127459969 missense probably damaging 1.00
R1994:Mgat5 UTSW 1 127459959 missense possibly damaging 0.82
R2054:Mgat5 UTSW 1 127397607 missense probably damaging 1.00
R2150:Mgat5 UTSW 1 127469250 missense probably damaging 1.00
R2303:Mgat5 UTSW 1 127446299 missense probably benign 0.00
R2566:Mgat5 UTSW 1 127307004 missense probably benign 0.01
R3788:Mgat5 UTSW 1 127366443 missense probably benign
R4674:Mgat5 UTSW 1 127390758 missense probably damaging 1.00
R4873:Mgat5 UTSW 1 127469249 missense probably damaging 1.00
R4875:Mgat5 UTSW 1 127469249 missense probably damaging 1.00
R5175:Mgat5 UTSW 1 127459912 missense probably damaging 0.97
R5310:Mgat5 UTSW 1 127387514 critical splice donor site probably null
R5337:Mgat5 UTSW 1 127459921 missense possibly damaging 0.84
R5597:Mgat5 UTSW 1 127397566 missense probably damaging 1.00
R5599:Mgat5 UTSW 1 127397566 missense probably damaging 1.00
R5861:Mgat5 UTSW 1 127387392 missense probably damaging 1.00
R5956:Mgat5 UTSW 1 127382939 missense probably benign 0.10
R6042:Mgat5 UTSW 1 127459899 missense probably damaging 1.00
R6223:Mgat5 UTSW 1 127382979 missense possibly damaging 0.86
R6492:Mgat5 UTSW 1 127471564 missense probably benign 0.36
R6662:Mgat5 UTSW 1 127469237 missense probably damaging 1.00
R6960:Mgat5 UTSW 1 127320634 missense possibly damaging 0.77
R6981:Mgat5 UTSW 1 127390851 missense probably damaging 0.98
R7110:Mgat5 UTSW 1 127382979 missense possibly damaging 0.92
R7133:Mgat5 UTSW 1 127365189 missense probably benign
R7142:Mgat5 UTSW 1 127412187 missense probably damaging 1.00
R7151:Mgat5 UTSW 1 127446262 missense probably damaging 0.97
R7506:Mgat5 UTSW 1 127366455 missense probably benign 0.24
R7790:Mgat5 UTSW 1 127412204 missense probably benign 0.23
R7980:Mgat5 UTSW 1 127479511 missense probably benign 0.13
X0028:Mgat5 UTSW 1 127366485 missense possibly damaging 0.91
Z1177:Mgat5 UTSW 1 127482692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGATGGGCTTTTGAAATCCTGG -3'
(R):5'- TCATCCACCTCGATGGGATG -3'

Sequencing Primer
(F):5'- TCCTGGATTTAATTGACTCTCAGG -3'
(R):5'- ACCTCGATGGGATGTCACTTGAC -3'
Posted On2015-04-02