Mutagenetix > Incidental Mutation

Incidental Mutation 'R3498:Mgat5'

273639

Institutional Source

Beutler Lab

Gene Symbol

Mgat5

Ensembl Gene

ENSMUSG00000036155

Gene Name

mannoside acetylglucosaminyltransferase 5

Synonyms

4930471A21Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV, 5330407H02Rik

MMRRC Submission

040661-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3498 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127205015-127488336 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127384834 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 237 (M237V)

Ref Sequence

ENSEMBL: ENSMUSP00000129166 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]

AlphaFold

Q8R4G6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038361
AA Change: M237V

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: M237V

Domain	Start	End	E-Value	Type
Pfam:DUF4525	2	138	3.4e-70	PFAM
Pfam:Glyco_transf_18	171	725	9.8e-268	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171405
AA Change: M237V

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: M237V

Domain	Start	End	E-Value	Type
Pfam:DUF4525	3	137	9.3e-64	PFAM
Pfam:Glyco_transf_18	171	725	1.9e-268	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189427

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190921

Meta Mutation Damage Score

0.3132

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
A3galt2	T	C	4: 128,755,557	F6L	probably benign	Het
Aurkc	A	G	7: 7,000,030	I175V	probably damaging	Het
Azi2	A	G	9: 118,049,407	D105G	probably damaging	Het
Bcat1	A	G	6: 145,019,342	V45A	probably damaging	Het
Cass4	C	T	2: 172,432,558	P753L	probably damaging	Het
Ddx42	A	G	11: 106,231,193	E178G	possibly damaging	Het
Dmpk	T	C	7: 19,086,381	I101T	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Fosb	C	T	7: 19,306,632	R161H	probably damaging	Het
Gm6729	T	C	10: 86,540,718		noncoding transcript	Het
Gnb1	T	A	4: 155,555,026	N237K	possibly damaging	Het
Gpr35	A	G	1: 92,983,391	Y275C	probably damaging	Het
Hmcn1	A	T	1: 150,605,102	I4441N	probably damaging	Het
Ighe	G	A	12: 113,271,374	Q389*	probably null	Het
Kcnj11	T	C	7: 46,099,602	D23G	probably damaging	Het
Lats2	G	T	14: 57,722,466	A191E	possibly damaging	Het
Lyplal1	A	G	1: 186,088,660	S197P	possibly damaging	Het
Map4	G	T	9: 110,035,212	V502L	probably benign	Het
Mindy4	A	G	6: 55,216,525	R68G	probably benign	Het
Nell1	T	A	7: 50,258,179	V362E	possibly damaging	Het
Olfr1031	T	A	2: 85,992,430	F204L	probably benign	Het
Olfr792	T	A	10: 129,540,909	I124N	probably damaging	Het
P4ha2	T	C	11: 54,119,253	Y279H	probably benign	Het
Pcid2	A	G	8: 13,100,413	V13A	possibly damaging	Het
Polr2j	T	C	5: 136,122,770	I116T	probably benign	Het
Prdm9	A	G	17: 15,562,945		probably benign	Het
Prr5	T	A	15: 84,703,144	V365E	probably benign	Het
Ptprf	A	T	4: 118,224,930	I1037N	probably damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Sde2	T	A	1: 180,858,185	C101S	probably damaging	Het
Sec1	T	C	7: 45,679,239	H128R	probably damaging	Het
Serpinb6a	A	T	13: 33,918,781	M253K	probably damaging	Het
Slc1a4	A	T	11: 20,313,973	I248N	probably damaging	Het
Slc22a4	T	G	11: 53,992,053	K328N	probably benign	Het
Slc24a4	A	T	12: 102,234,692	K278N	probably benign	Het
Slc6a21	T	A	7: 45,280,842	W222R	probably damaging	Het
Slc7a2	A	G	8: 40,912,530	E466G	probably benign	Het
Sspo	A	G	6: 48,467,980	T2133A	possibly damaging	Het
Taco1	A	G	11: 106,072,538	M172V	probably benign	Het
Tmem127	T	A	2: 127,256,120	H36Q	probably benign	Het
Tmem229b-ps	C	T	10: 53,475,127		noncoding transcript	Het
Vac14	A	G	8: 110,671,090	D479G	probably benign	Het
Vmn1r176	T	A	7: 23,835,242	K162I	probably benign	Het

Other mutations in Mgat5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Mgat5	APN	1	127387467	missense	probably damaging	1.00
IGL00813:Mgat5	APN	1	127384806	missense	probably benign
IGL01795:Mgat5	APN	1	127469231	missense	probably damaging	0.98
IGL01830:Mgat5	APN	1	127412132	missense	probably damaging	1.00
IGL01879:Mgat5	APN	1	127397550	missense	probably damaging	0.99
IGL02322:Mgat5	APN	1	127382985	missense	probably benign	0.00
IGL02621:Mgat5	APN	1	127397589	missense	possibly damaging	0.86
IGL02695:Mgat5	APN	1	127412131	missense	probably damaging	1.00
IGL03142:Mgat5	APN	1	127412223	missense	probably damaging	1.00
Cowlick	UTSW	1	127471564	missense	probably benign	0.36
Curls	UTSW	1	127320634	missense	possibly damaging	0.77
R0518:Mgat5	UTSW	1	127384847	missense	probably damaging	1.00
R0594:Mgat5	UTSW	1	127412248	missense	probably damaging	0.96
R1480:Mgat5	UTSW	1	127459979	missense	probably damaging	1.00
R1501:Mgat5	UTSW	1	127397641	critical splice donor site	probably null
R1712:Mgat5	UTSW	1	127320638	missense	probably benign	0.34
R1744:Mgat5	UTSW	1	127479469	missense	probably damaging	1.00
R1862:Mgat5	UTSW	1	127459969	missense	probably damaging	1.00
R1994:Mgat5	UTSW	1	127459959	missense	possibly damaging	0.82
R2054:Mgat5	UTSW	1	127397607	missense	probably damaging	1.00
R2150:Mgat5	UTSW	1	127469250	missense	probably damaging	1.00
R2303:Mgat5	UTSW	1	127446299	missense	probably benign	0.00
R2566:Mgat5	UTSW	1	127307004	missense	probably benign	0.01
R3788:Mgat5	UTSW	1	127366443	missense	probably benign
R4674:Mgat5	UTSW	1	127390758	missense	probably damaging	1.00
R4873:Mgat5	UTSW	1	127469249	missense	probably damaging	1.00
R4875:Mgat5	UTSW	1	127469249	missense	probably damaging	1.00
R5175:Mgat5	UTSW	1	127459912	missense	probably damaging	0.97
R5310:Mgat5	UTSW	1	127387514	critical splice donor site	probably null
R5337:Mgat5	UTSW	1	127459921	missense	possibly damaging	0.84
R5597:Mgat5	UTSW	1	127397566	missense	probably damaging	1.00
R5599:Mgat5	UTSW	1	127397566	missense	probably damaging	1.00
R5861:Mgat5	UTSW	1	127387392	missense	probably damaging	1.00
R5956:Mgat5	UTSW	1	127382939	missense	probably benign	0.10
R6042:Mgat5	UTSW	1	127459899	missense	probably damaging	1.00
R6223:Mgat5	UTSW	1	127382979	missense	possibly damaging	0.86
R6492:Mgat5	UTSW	1	127471564	missense	probably benign	0.36
R6662:Mgat5	UTSW	1	127469237	missense	probably damaging	1.00
R6960:Mgat5	UTSW	1	127320634	missense	possibly damaging	0.77
R6981:Mgat5	UTSW	1	127390851	missense	probably damaging	0.98
R7110:Mgat5	UTSW	1	127382979	missense	possibly damaging	0.92
R7133:Mgat5	UTSW	1	127365189	missense	probably benign
R7142:Mgat5	UTSW	1	127412187	missense	probably damaging	1.00
R7151:Mgat5	UTSW	1	127446262	missense	probably damaging	0.97
R7506:Mgat5	UTSW	1	127366455	missense	probably benign	0.24
R7790:Mgat5	UTSW	1	127412204	missense	probably benign	0.23
R7980:Mgat5	UTSW	1	127479511	missense	probably benign	0.13
R8548:Mgat5	UTSW	1	127320672	missense	possibly damaging	0.77
R9008:Mgat5	UTSW	1	127479571	missense	probably damaging	1.00
R9127:Mgat5	UTSW	1	127366460	missense	probably benign	0.14
R9279:Mgat5	UTSW	1	127397611	missense	probably damaging	1.00
R9599:Mgat5	UTSW	1	127320708	missense	probably benign	0.02
X0028:Mgat5	UTSW	1	127366485	missense	possibly damaging	0.91
Z1177:Mgat5	UTSW	1	127482692	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGATGGGCTTTTGAAATCCTGG -3'
(R):5'- TCATCCACCTCGATGGGATG -3'

Sequencing Primer
(F):5'- TCCTGGATTTAATTGACTCTCAGG -3'
(R):5'- ACCTCGATGGGATGTCACTTGAC -3'

Posted On

2015-04-02