Incidental Mutation 'R3498:Or5m8'
ID 273643
Institutional Source Beutler Lab
Gene Symbol Or5m8
Ensembl Gene ENSMUSG00000043267
Gene Name olfactory receptor family 5 subfamily M member 8
Synonyms GA_x6K02T2Q125-47470765-47471775, Olfr1031, MOR200-1
MMRRC Submission 040661-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R3498 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 85822163-85823173 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85822774 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 204 (F204L)
Ref Sequence ENSEMBL: ENSMUSP00000149225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050942] [ENSMUST00000056849] [ENSMUST00000216807]
AlphaFold Q7TR87
Predicted Effect probably benign
Transcript: ENSMUST00000050942
AA Change: F204L

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059256
Gene: ENSMUSG00000043267
AA Change: F204L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.1e-55 PFAM
Pfam:7tm_1 40 289 6.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056849
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216807
AA Change: F204L

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,649,350 (GRCm39) F6L probably benign Het
Aurkc A G 7: 7,003,029 (GRCm39) I175V probably damaging Het
Azi2 A G 9: 117,878,475 (GRCm39) D105G probably damaging Het
Bcat1 A G 6: 144,965,068 (GRCm39) V45A probably damaging Het
Cass4 C T 2: 172,274,478 (GRCm39) P753L probably damaging Het
Cimip3 AC A 17: 47,744,348 (GRCm39) probably benign Het
Ddx42 A G 11: 106,122,019 (GRCm39) E178G possibly damaging Het
Dmpk T C 7: 18,820,306 (GRCm39) I101T probably damaging Het
Dnah17 C T 11: 117,971,675 (GRCm39) probably benign Het
Fosb C T 7: 19,040,557 (GRCm39) R161H probably damaging Het
Gm6729 T C 10: 86,376,582 (GRCm39) noncoding transcript Het
Gnb1 T A 4: 155,639,483 (GRCm39) N237K possibly damaging Het
Gpr35 A G 1: 92,911,113 (GRCm39) Y275C probably damaging Het
Hmcn1 A T 1: 150,480,853 (GRCm39) I4441N probably damaging Het
Ighe G A 12: 113,234,994 (GRCm39) Q389* probably null Het
Kcnj11 T C 7: 45,749,026 (GRCm39) D23G probably damaging Het
Lats2 G T 14: 57,959,923 (GRCm39) A191E possibly damaging Het
Lyplal1 A G 1: 185,820,857 (GRCm39) S197P possibly damaging Het
Map4 G T 9: 109,864,280 (GRCm39) V502L probably benign Het
Mgat5 A G 1: 127,312,571 (GRCm39) M237V possibly damaging Het
Mindy4 A G 6: 55,193,510 (GRCm39) R68G probably benign Het
Nell1 T A 7: 49,907,927 (GRCm39) V362E possibly damaging Het
Or6c66b T A 10: 129,376,778 (GRCm39) I124N probably damaging Het
P4ha2 T C 11: 54,010,079 (GRCm39) Y279H probably benign Het
Pcid2 A G 8: 13,150,413 (GRCm39) V13A possibly damaging Het
Polr2j T C 5: 136,151,624 (GRCm39) I116T probably benign Het
Prdm9 A G 17: 15,783,207 (GRCm39) probably benign Het
Prr5 T A 15: 84,587,345 (GRCm39) V365E probably benign Het
Ptprf A T 4: 118,082,127 (GRCm39) I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,169,203 (GRCm39) probably benign Het
Sde2 T A 1: 180,685,750 (GRCm39) C101S probably damaging Het
Sec1 T C 7: 45,328,663 (GRCm39) H128R probably damaging Het
Serpinb6a A T 13: 34,102,764 (GRCm39) M253K probably damaging Het
Slc1a4 A T 11: 20,263,973 (GRCm39) I248N probably damaging Het
Slc22a4 T G 11: 53,882,879 (GRCm39) K328N probably benign Het
Slc24a4 A T 12: 102,200,951 (GRCm39) K278N probably benign Het
Slc6a21 T A 7: 44,930,266 (GRCm39) W222R probably damaging Het
Slc7a2 A G 8: 41,365,567 (GRCm39) E466G probably benign Het
Sspo A G 6: 48,444,914 (GRCm39) T2133A possibly damaging Het
Taco1 A G 11: 105,963,364 (GRCm39) M172V probably benign Het
Tmem127 T A 2: 127,098,040 (GRCm39) H36Q probably benign Het
Tmem229b-ps C T 10: 53,351,223 (GRCm39) noncoding transcript Het
Vac14 A G 8: 111,397,722 (GRCm39) D479G probably benign Het
Vmn1r176 T A 7: 23,534,667 (GRCm39) K162I probably benign Het
Other mutations in Or5m8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Or5m8 APN 2 85,822,730 (GRCm39) missense probably damaging 1.00
IGL02475:Or5m8 APN 2 85,822,376 (GRCm39) missense probably benign 0.19
IGL03230:Or5m8 APN 2 85,822,583 (GRCm39) missense probably benign 0.00
IGL03405:Or5m8 APN 2 85,822,230 (GRCm39) missense possibly damaging 0.84
PIT4151001:Or5m8 UTSW 2 85,822,538 (GRCm39) missense probably damaging 0.96
PIT4366001:Or5m8 UTSW 2 85,822,385 (GRCm39) missense probably damaging 1.00
R0344:Or5m8 UTSW 2 85,822,726 (GRCm39) nonsense probably null
R1168:Or5m8 UTSW 2 85,823,028 (GRCm39) missense probably damaging 1.00
R1170:Or5m8 UTSW 2 85,823,040 (GRCm39) missense probably damaging 1.00
R2345:Or5m8 UTSW 2 85,822,166 (GRCm39) missense probably benign 0.01
R2915:Or5m8 UTSW 2 85,822,389 (GRCm39) missense probably damaging 1.00
R4058:Or5m8 UTSW 2 85,822,576 (GRCm39) missense possibly damaging 0.87
R4747:Or5m8 UTSW 2 85,822,271 (GRCm39) missense probably damaging 1.00
R4859:Or5m8 UTSW 2 85,823,075 (GRCm39) missense probably damaging 0.96
R4991:Or5m8 UTSW 2 85,822,631 (GRCm39) missense probably damaging 0.99
R5438:Or5m8 UTSW 2 85,822,925 (GRCm39) missense probably damaging 1.00
R6362:Or5m8 UTSW 2 85,822,285 (GRCm39) missense probably damaging 1.00
R7458:Or5m8 UTSW 2 85,822,994 (GRCm39) missense probably damaging 1.00
R7535:Or5m8 UTSW 2 85,822,245 (GRCm39) missense probably benign 0.37
R8807:Or5m8 UTSW 2 85,823,172 (GRCm39) makesense probably null
R9130:Or5m8 UTSW 2 85,822,819 (GRCm39) nonsense probably null
R9366:Or5m8 UTSW 2 85,822,731 (GRCm39) missense possibly damaging 0.88
R9687:Or5m8 UTSW 2 85,822,220 (GRCm39) missense probably benign
R9746:Or5m8 UTSW 2 85,823,091 (GRCm39) missense probably benign 0.18
R9794:Or5m8 UTSW 2 85,822,464 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGATGTCCCAGAGTGTATGCAC -3'
(R):5'- ACAGACTCTCTAGATGTTGGTCTG -3'

Sequencing Primer
(F):5'- GTATGCACATCTCTAATCACAGTGC -3'
(R):5'- ACTCTCTAGATGTTGGTCTGAGATAC -3'
Posted On 2015-04-02