Mutagenetix > Incidental Mutations

Incidental Mutation 'R3498:Ptprf'

273647

Institutional Source

Beutler Lab

Gene Symbol

Ptprf

Ensembl Gene

ENSMUSG00000033295

Gene Name

protein tyrosine phosphatase, receptor type, F

Synonyms

RPTP-LAR, LAR

MMRRC Submission

040661-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.672) question?

Stock #

R3498 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118208213-118291405 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118224930 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1037 (I1037N)

Ref Sequence

ENSEMBL: ENSMUSP00000039368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049074]

PDB Structure

Tandem Ig domains of tyrosine phosphatase LAR [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049074
AA Change: I1037N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: I1037N

Domain	Start	End	E-Value	Type
IGc2	45	114	2.64e-12	SMART
IGc2	147	214	1.48e-15	SMART
IG	238	316	1.06e-11	SMART
FN3	319	398	6.9e-14	SMART
FN3	414	497	5.73e-11	SMART
FN3	512	591	4.06e-11	SMART
FN3	606	693	8.69e-11	SMART
FN3	709	797	8.83e-12	SMART
FN3	812	892	3.2e-9	SMART
FN3	907	988	2.53e-12	SMART
FN3	1003	1079	3.48e-1	SMART
coiled coil region	1146	1175	N/A	INTRINSIC
transmembrane domain	1253	1275	N/A	INTRINSIC
PTPc	1342	1600	1.12e-138	SMART
PTPc	1629	1891	3.4e-129	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000124758
AA Change: I459N

SMART Domains

Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295
AA Change: I459N

Domain	Start	End	E-Value	Type
FN3	37	116	4.06e-11	SMART
FN3	132	220	8.83e-12	SMART
FN3	235	315	3.2e-9	SMART
FN3	330	411	2.53e-12	SMART
FN3	426	502	3.48e-1	SMART
coiled coil region	568	597	N/A	INTRINSIC
transmembrane domain	676	698	N/A	INTRINSIC
PTPc	776	1034	1.12e-138	SMART
PTPc	1063	1325	3.4e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143348

Predicted Effect

unknown
Transcript: ENSMUST00000150096
AA Change: I418N

SMART Domains

Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: I418N

Domain	Start	End	E-Value	Type
FN3	14	66	2.7e1	SMART
FN3	82	165	5.73e-11	SMART
FN3	180	259	4.06e-11	SMART
FN3	275	372	6.69e-12	SMART
FN3	385	461	2.83e-1	SMART
coiled coil region	527	556	N/A	INTRINSIC
transmembrane domain	635	657	N/A	INTRINSIC
PTPc	735	993	1.12e-138	SMART
PTPc	1022	1284	3.4e-129	SMART

Meta Mutation Damage Score

0.5072

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
A3galt2	T	C	4: 128,755,557	F6L	probably benign	Het
Aurkc	A	G	7: 7,000,030	I175V	probably damaging	Het
Azi2	A	G	9: 118,049,407	D105G	probably damaging	Het
Bcat1	A	G	6: 145,019,342	V45A	probably damaging	Het
Cass4	C	T	2: 172,432,558	P753L	probably damaging	Het
Ddx42	A	G	11: 106,231,193	E178G	possibly damaging	Het
Dmpk	T	C	7: 19,086,381	I101T	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Fosb	C	T	7: 19,306,632	R161H	probably damaging	Het
Gm6729	T	C	10: 86,540,718		noncoding transcript	Het
Gnb1	T	A	4: 155,555,026	N237K	possibly damaging	Het
Gpr35	A	G	1: 92,983,391	Y275C	probably damaging	Het
Hmcn1	A	T	1: 150,605,102	I4441N	probably damaging	Het
Ighe	G	A	12: 113,271,374	Q389*	probably null	Het
Kcnj11	T	C	7: 46,099,602	D23G	probably damaging	Het
Lats2	G	T	14: 57,722,466	A191E	possibly damaging	Het
Lyplal1	A	G	1: 186,088,660	S197P	possibly damaging	Het
Map4	G	T	9: 110,035,212	V502L	probably benign	Het
Mgat5	A	G	1: 127,384,834	M237V	possibly damaging	Het
Mindy4	A	G	6: 55,216,525	R68G	probably benign	Het
Nell1	T	A	7: 50,258,179	V362E	possibly damaging	Het
Olfr1031	T	A	2: 85,992,430	F204L	probably benign	Het
Olfr792	T	A	10: 129,540,909	I124N	probably damaging	Het
P4ha2	T	C	11: 54,119,253	Y279H	probably benign	Het
Pcid2	A	G	8: 13,100,413	V13A	possibly damaging	Het
Polr2j	T	C	5: 136,122,770	I116T	probably benign	Het
Prdm9	A	G	17: 15,562,945		probably benign	Het
Prr5	T	A	15: 84,703,144	V365E	probably benign	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Sde2	T	A	1: 180,858,185	C101S	probably damaging	Het
Sec1	T	C	7: 45,679,239	H128R	probably damaging	Het
Serpinb6a	A	T	13: 33,918,781	M253K	probably damaging	Het
Slc1a4	A	T	11: 20,313,973	I248N	probably damaging	Het
Slc22a4	T	G	11: 53,992,053	K328N	probably benign	Het
Slc24a4	A	T	12: 102,234,692	K278N	probably benign	Het
Slc6a21	T	A	7: 45,280,842	W222R	probably damaging	Het
Slc7a2	A	G	8: 40,912,530	E466G	probably benign	Het
Sspo	A	G	6: 48,467,980	T2133A	possibly damaging	Het
Taco1	A	G	11: 106,072,538	M172V	probably benign	Het
Tmem127	T	A	2: 127,256,120	H36Q	probably benign	Het
Tmem229b-ps	C	T	10: 53,475,127		noncoding transcript	Het
Vac14	A	G	8: 110,671,090	D479G	probably benign	Het
Vmn1r176	T	A	7: 23,835,242	K162I	probably benign	Het

Other mutations in Ptprf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Ptprf	APN	4	118223220	splice site	probably benign
IGL01337:Ptprf	APN	4	118236291	missense	probably damaging	1.00
IGL01482:Ptprf	APN	4	118212454	missense	probably damaging	1.00
IGL01743:Ptprf	APN	4	118248898	critical splice donor site	probably null
IGL01987:Ptprf	APN	4	118277370	missense	probably benign
IGL02189:Ptprf	APN	4	118213642	splice site	probably benign
IGL03067:Ptprf	APN	4	118210713	missense	possibly damaging	0.67
PIT4677001:Ptprf	UTSW	4	118213612	missense	probably damaging	1.00
R0382:Ptprf	UTSW	4	118223394	splice site	probably benign
R0788:Ptprf	UTSW	4	118226466	missense	probably damaging	0.97
R1164:Ptprf	UTSW	4	118257492	missense	probably damaging	1.00
R1478:Ptprf	UTSW	4	118212105	nonsense	probably null
R1483:Ptprf	UTSW	4	118235964	missense	possibly damaging	0.81
R1611:Ptprf	UTSW	4	118236233	missense	probably benign	0.34
R1721:Ptprf	UTSW	4	118224899	missense	possibly damaging	0.56
R1817:Ptprf	UTSW	4	118223265	missense	probably benign	0.02
R1818:Ptprf	UTSW	4	118209871	missense	probably damaging	1.00
R1860:Ptprf	UTSW	4	118223932	missense	probably damaging	1.00
R2208:Ptprf	UTSW	4	118269172	splice site	probably benign
R2406:Ptprf	UTSW	4	118269304	missense	possibly damaging	0.62
R2912:Ptprf	UTSW	4	118248980	missense	probably damaging	0.98
R3111:Ptprf	UTSW	4	118211432	missense	probably damaging	1.00
R3499:Ptprf	UTSW	4	118224930	missense	probably damaging	0.99
R3615:Ptprf	UTSW	4	118237883	missense	probably benign	0.04
R3616:Ptprf	UTSW	4	118237883	missense	probably benign	0.04
R4038:Ptprf	UTSW	4	118257608	missense	probably damaging	1.00
R4243:Ptprf	UTSW	4	118226452	critical splice donor site	probably null
R4260:Ptprf	UTSW	4	118226083	missense	possibly damaging	0.64
R4693:Ptprf	UTSW	4	118211022	missense	probably benign	0.16
R4726:Ptprf	UTSW	4	118212217	missense	possibly damaging	0.86
R4746:Ptprf	UTSW	4	118225039	missense	possibly damaging	0.83
R4802:Ptprf	UTSW	4	118210329	intron	probably benign
R4857:Ptprf	UTSW	4	118217197	splice site	probably benign
R5071:Ptprf	UTSW	4	118211999	missense	probably damaging	1.00
R5221:Ptprf	UTSW	4	118225108	missense	probably benign	0.00
R5327:Ptprf	UTSW	4	118236389	missense	probably damaging	1.00
R5336:Ptprf	UTSW	4	118235634	missense	probably damaging	1.00
R5356:Ptprf	UTSW	4	118226338	missense	probably benign	0.00
R5373:Ptprf	UTSW	4	118226041	missense	possibly damaging	0.93
R5555:Ptprf	UTSW	4	118224924	missense	probably damaging	1.00
R5693:Ptprf	UTSW	4	118236177	nonsense	probably null
R5860:Ptprf	UTSW	4	118211289	intron	probably benign
R5869:Ptprf	UTSW	4	118210382	missense	probably damaging	1.00
R5890:Ptprf	UTSW	4	118224735	missense	probably benign
R5932:Ptprf	UTSW	4	118211767	missense	probably benign	0.10
R6028:Ptprf	UTSW	4	118213629	missense	probably benign	0.01
R6030:Ptprf	UTSW	4	118211048	missense	probably benign	0.19
R6030:Ptprf	UTSW	4	118211048	missense	probably benign	0.19
R6088:Ptprf	UTSW	4	118210755	missense	possibly damaging	0.68
R6089:Ptprf	UTSW	4	118211084	missense	probably damaging	0.99
R6108:Ptprf	UTSW	4	118223256	missense	probably benign	0.01
R6320:Ptprf	UTSW	4	118212814	missense	probably benign
R6741:Ptprf	UTSW	4	118223368	missense	probably benign	0.00
R6744:Ptprf	UTSW	4	118236365	missense	probably benign	0.00
R6750:Ptprf	UTSW	4	118231731	missense	probably benign	0.03
R6906:Ptprf	UTSW	4	118269277	missense	possibly damaging	0.95
R7021:Ptprf	UTSW	4	118223904	missense	probably benign	0.00
R7153:Ptprf	UTSW	4	118231543	missense	probably damaging	1.00
R7326:Ptprf	UTSW	4	118231669	missense	probably damaging	0.99
R7337:Ptprf	UTSW	4	118211125	missense	probably damaging	0.99
R7374:Ptprf	UTSW	4	118257492	missense	probably damaging	1.00
R7375:Ptprf	UTSW	4	118212814	missense	probably benign
R7399:Ptprf	UTSW	4	118226523	missense	probably benign	0.28
R7417:Ptprf	UTSW	4	118212172	missense	probably damaging	1.00
R7448:Ptprf	UTSW	4	118235667	missense	probably benign	0.03
R7530:Ptprf	UTSW	4	118212748	missense	probably damaging	1.00
R7593:Ptprf	UTSW	4	118212396	missense	probably benign	0.00
R8172:Ptprf	UTSW	4	118211078	missense	probably benign	0.03
R8239:Ptprf	UTSW	4	118212112	missense	possibly damaging	0.88
R8257:Ptprf	UTSW	4	118226279	missense	probably damaging	0.96
R8331:Ptprf	UTSW	4	118226066	missense	probably benign	0.27
X0067:Ptprf	UTSW	4	118236026	missense	possibly damaging	0.85
Z1177:Ptprf	UTSW	4	118269615	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CCATCCTCTATAAAGGCGGAG -3'
(R):5'- GTTTGCCAAGAATTTCCGTGTG -3'

Sequencing Primer
(F):5'- GCAGGCAGTGGCTTCTG -3'
(R):5'- AAGAATTTCCGTGTGGCCGC -3'

Posted On

2015-04-02