Incidental Mutation 'R3498:Gnb1'
ID273648
Institutional Source Beutler Lab
Gene Symbol Gnb1
Ensembl Gene ENSMUSG00000029064
Gene Nameguanine nucleotide binding protein (G protein), beta 1
Synonyms
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155491361-155559269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155555026 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 237 (N237K)
Ref Sequence ENSEMBL: ENSMUSP00000135492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030940] [ENSMUST00000105616] [ENSMUST00000165335] [ENSMUST00000176637] [ENSMUST00000177094]
Predicted Effect probably benign
Transcript: ENSMUST00000030940
AA Change: N237K

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030940
Gene: ENSMUSG00000029064
AA Change: N237K

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
WD40 257 298 1.88e-4 SMART
WD40 301 340 3.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105616
AA Change: N237K

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101241
Gene: ENSMUSG00000029064
AA Change: N237K

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
WD40 257 298 1.88e-4 SMART
WD40 301 340 3.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165335
AA Change: N237K

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130123
Gene: ENSMUSG00000029064
AA Change: N237K

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
WD40 257 298 1.88e-4 SMART
WD40 301 340 3.55e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176308
Predicted Effect probably benign
Transcript: ENSMUST00000176637
AA Change: N237K

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135091
Gene: ENSMUSG00000029064
AA Change: N237K

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
WD40 257 298 1.88e-4 SMART
WD40 301 340 3.55e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177094
AA Change: N237K

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135492
Gene: ENSMUSG00000029064
AA Change: N237K

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
Meta Mutation Damage Score 0.1720 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Heterozygous null mice have an abnormal retina morphology with progressive degeneration. Mice homozygous for a mutation of this gene show prenatal or perinatal lethality with exencephaly and/or small brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Gnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Gnb1 APN 4 155543188 missense probably damaging 1.00
IGL02052:Gnb1 APN 4 155533691 splice site probably benign
IGL02164:Gnb1 APN 4 155557174 splice site probably null
IGL02470:Gnb1 APN 4 155527513 splice site probably benign
IGL02928:Gnb1 APN 4 155553406 missense probably benign
IGL03293:Gnb1 APN 4 155540547 splice site probably benign
R0034:Gnb1 UTSW 4 155551689 missense probably benign 0.03
R0325:Gnb1 UTSW 4 155551683 missense probably benign 0.21
R1538:Gnb1 UTSW 4 155551714 missense probably benign 0.00
R4177:Gnb1 UTSW 4 155540656 intron probably benign
R4746:Gnb1 UTSW 4 155543074 missense probably damaging 1.00
R4833:Gnb1 UTSW 4 155543067 missense possibly damaging 0.57
R5727:Gnb1 UTSW 4 155555102 missense probably benign 0.00
R6958:Gnb1 UTSW 4 155543194 critical splice donor site probably null
R7022:Gnb1 UTSW 4 155553456 missense probably damaging 1.00
R8321:Gnb1 UTSW 4 155555025 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGACCTTGAATTCACTATGTGCCTG -3'
(R):5'- GCTTTGAGTGCATCCCAGAC -3'

Sequencing Primer
(F):5'- CTGAAGGCTGTGTACTCTATTCCATG -3'
(R):5'- GAGTGCATCCCAGACATTACAGTTG -3'
Posted On2015-04-02