Incidental Mutation 'R3498:Polr2j'
ID273649
Institutional Source Beutler Lab
Gene Symbol Polr2j
Ensembl Gene ENSMUSG00000039771
Gene Namepolymerase (RNA) II (DNA directed) polypeptide J
SynonymsRpo2-4, RNA polymerase II subunit RPB14, 14.5kDa, Rpb11a
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.622) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location136116631-136122947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136122770 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 116 (I116T)
Ref Sequence ENSEMBL: ENSMUSP00000038505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006301] [ENSMUST00000041366] [ENSMUST00000111127] [ENSMUST00000111129]
Predicted Effect probably benign
Transcript: ENSMUST00000006301
SMART Domains Protein: ENSMUSP00000006301
Gene: ENSMUSG00000029703

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
LRR_TYP 46 69 3.16e-3 SMART
LRR 90 113 1.58e2 SMART
WD40 271 327 6.36e1 SMART
Blast:WD40 330 380 2e-12 BLAST
WD40 383 423 1.49e-7 SMART
WD40 434 473 2.28e2 SMART
Blast:WD40 484 527 6e-15 BLAST
WD40 542 583 1.42e2 SMART
low complexity region 591 602 N/A INTRINSIC
Blast:WD40 603 646 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000041366
AA Change: I116T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000038505
Gene: ENSMUSG00000039771
AA Change: I116T

DomainStartEndE-ValueType
Pfam:RNA_pol_L_2 30 104 5.3e-32 PFAM
Pfam:RNA_pol_L 32 98 4.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111127
SMART Domains Protein: ENSMUSP00000106757
Gene: ENSMUSG00000039771

DomainStartEndE-ValueType
Pfam:RNA_pol_L_2 29 105 3.6e-33 PFAM
Pfam:RNA_pol_L 31 99 1.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111129
AA Change: I86T

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106759
Gene: ENSMUSG00000039771
AA Change: I86T

DomainStartEndE-ValueType
Pfam:RNA_pol_L 17 69 2.7e-9 PFAM
Pfam:RNA_pol_L_2 17 75 1.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128255
SMART Domains Protein: ENSMUSP00000119546
Gene: ENSMUSG00000029703

DomainStartEndE-ValueType
Blast:WD40 13 66 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199799
Meta Mutation Damage Score 0.1186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene exists as a heterodimer with another polymerase subunit; together they form a core subassembly unit of the polymerase. Two similar genes are located nearby on chromosome 7q22.1 and a pseudogene is found on chromosome 7p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Polr2j
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1576:Polr2j UTSW 5 136120028 missense probably damaging 1.00
R2085:Polr2j UTSW 5 136116771 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCTGGAGCCTTTGGAGACTG -3'
(R):5'- TTGGTTAACTCAGGCAGGCC -3'

Sequencing Primer
(F):5'- AGCCTTTGGAGACTGGTCCAC -3'
(R):5'- GTCTGAGTGACAGTCCACAC -3'
Posted On2015-04-02