Incidental Mutation 'R3498:Bcat1'
ID273653
Institutional Source Beutler Lab
Gene Symbol Bcat1
Ensembl Gene ENSMUSG00000030268
Gene Namebranched chain aminotransferase 1, cytosolic
SynonymsEca39, Bcat-1, BCATc
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location144993835-145076184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145019342 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 45 (V45A)
Ref Sequence ENSEMBL: ENSMUSP00000144968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032402] [ENSMUST00000048252] [ENSMUST00000111742] [ENSMUST00000123930] [ENSMUST00000204138]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032402
AA Change: V242A

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032402
Gene: ENSMUSG00000030268
AA Change: V242A

DomainStartEndE-ValueType
Pfam:Aminotran_4 160 410 1.3e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000048252
AA Change: V175A

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039744
Gene: ENSMUSG00000030268
AA Change: V175A

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 5.9e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111742
AA Change: V175A

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107371
Gene: ENSMUSG00000030268
AA Change: V175A

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 1.7e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123930
AA Change: V174A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120180
Gene: ENSMUSG00000030268
AA Change: V174A

DomainStartEndE-ValueType
PDB:2COJ|B 2 224 1e-139 PDB
SCOP:d1ekfa_ 21 224 1e-76 SMART
Blast:FN3 129 192 5e-7 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000136819
AA Change: V25A
SMART Domains Protein: ENSMUSP00000117708
Gene: ENSMUSG00000030268
AA Change: V25A

DomainStartEndE-ValueType
PDB:2COJ|B 2 76 2e-45 PDB
SCOP:d1ekfa_ 2 76 2e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145911
Predicted Effect probably damaging
Transcript: ENSMUST00000204138
AA Change: V45A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144968
Gene: ENSMUSG00000030268
AA Change: V45A

DomainStartEndE-ValueType
Pfam:Aminotran_4 34 180 9.1e-17 PFAM
Meta Mutation Damage Score 0.5476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal amino acid metabilism in T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Bcat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcat1 APN 6 145000289 missense possibly damaging 0.89
IGL01882:Bcat1 APN 6 145004409 missense probably damaging 1.00
IGL02021:Bcat1 APN 6 145047289 splice site probably benign
IGL02024:Bcat1 APN 6 145032838 missense probably damaging 0.97
IGL02705:Bcat1 APN 6 145019188 splice site probably benign
IGL02954:Bcat1 APN 6 145019219 missense probably damaging 1.00
R0331:Bcat1 UTSW 6 145047314 missense probably benign 0.17
R1592:Bcat1 UTSW 6 145010058 missense probably benign 0.00
R1680:Bcat1 UTSW 6 145039628 missense probably damaging 1.00
R2162:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R2306:Bcat1 UTSW 6 145007653 missense probably damaging 0.96
R3758:Bcat1 UTSW 6 145032872 missense probably damaging 1.00
R3831:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R3833:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R4829:Bcat1 UTSW 6 145015475 missense probably damaging 1.00
R5250:Bcat1 UTSW 6 145047439 critical splice donor site probably null
R5338:Bcat1 UTSW 6 145007627 missense possibly damaging 0.50
R5414:Bcat1 UTSW 6 145015447 critical splice donor site probably null
R5679:Bcat1 UTSW 6 145007748 missense probably damaging 1.00
R6566:Bcat1 UTSW 6 145015484 missense probably damaging 1.00
R7015:Bcat1 UTSW 6 145039583 missense probably damaging 0.99
R7255:Bcat1 UTSW 6 145032785 nonsense probably null
R7606:Bcat1 UTSW 6 145048632 missense probably benign 0.06
R8115:Bcat1 UTSW 6 145010093 missense probably damaging 1.00
RF004:Bcat1 UTSW 6 145007623 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAAGCGCACAACTGTCAC -3'
(R):5'- AACTGCAACTGACAGCTGTG -3'

Sequencing Primer
(F):5'- CTGTCACTATACAGGAAGGACACAG -3'
(R):5'- CAAGCATTTATCCACTGAGGCATCTG -3'
Posted On2015-04-02