Incidental Mutation 'R3498:Fosb'
ID273656
Institutional Source Beutler Lab
Gene Symbol Fosb
Ensembl Gene ENSMUSG00000003545
Gene NameFBJ osteosarcoma oncogene B
Synonyms
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19302696-19310051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19306632 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 161 (R161H)
Ref Sequence ENSEMBL: ENSMUSP00000146789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003640] [ENSMUST00000207334] [ENSMUST00000207716] [ENSMUST00000208326] [ENSMUST00000208446] [ENSMUST00000208505]
Predicted Effect probably damaging
Transcript: ENSMUST00000003640
AA Change: R161H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003640
Gene: ENSMUSG00000003545
AA Change: R161H

DomainStartEndE-ValueType
low complexity region 113 132 N/A INTRINSIC
BRLZ 153 217 5.58e-13 SMART
low complexity region 255 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207334
Predicted Effect probably benign
Transcript: ENSMUST00000207716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208230
Predicted Effect probably damaging
Transcript: ENSMUST00000208326
AA Change: R122H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000208446
AA Change: R161H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208505
Meta Mutation Damage Score 0.2412 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show impaired nurturing behavior, altered behavioral tolerance to repeated motor seizures, reduced NMDA-mediated synaptic currents, and altered paradoxical sleep. Aging mice homozygous for another null allele may exhibit occasional tonic-clonic or generalized seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Fosb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Fosb APN 7 19307114 splice site probably null
R0183:Fosb UTSW 7 19307385 missense probably damaging 0.99
R0374:Fosb UTSW 7 19307150 missense probably damaging 0.99
R0555:Fosb UTSW 7 19307213 missense possibly damaging 0.84
R2329:Fosb UTSW 7 19307185 missense probably benign
R4064:Fosb UTSW 7 19305192 nonsense probably null
R4790:Fosb UTSW 7 19309388 missense probably damaging 1.00
R6327:Fosb UTSW 7 19307227 missense probably benign
R6605:Fosb UTSW 7 19309358 missense probably damaging 1.00
R7282:Fosb UTSW 7 19305188 missense possibly damaging 0.62
R7444:Fosb UTSW 7 19307274 missense possibly damaging 0.86
R7764:Fosb UTSW 7 19305046 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGAGCATGCATATGGAGCCAC -3'
(R):5'- AGGCCTCAAGTCTGAAGGAAC -3'

Sequencing Primer
(F):5'- ATACTGACCCCTGTTCCCTAAGAGG -3'
(R):5'- GAACTTTACCATTCTGGCCAGTGAG -3'
Posted On2015-04-02