Incidental Mutation 'R3498:Vmn1r176'
ID273657
Institutional Source Beutler Lab
Gene Symbol Vmn1r176
Ensembl Gene ENSMUSG00000096859
Gene Namevomeronasal 1 receptor 176
SynonymsGm5998
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23833840-23837372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23835242 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 162 (K162I)
Ref Sequence ENSEMBL: ENSMUSP00000153879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171073] [ENSMUST00000226319] [ENSMUST00000226767] [ENSMUST00000227129] [ENSMUST00000227661] [ENSMUST00000228280] [ENSMUST00000228793]
Predicted Effect probably benign
Transcript: ENSMUST00000171073
AA Change: K162I

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132168
Gene: ENSMUSG00000096859
AA Change: K162I

DomainStartEndE-ValueType
Pfam:7tm_1 5 288 5.4e-6 PFAM
Pfam:TAS2R 8 295 1.8e-13 PFAM
Pfam:V1R 41 295 1.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226319
AA Change: K162I

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000226767
AA Change: K162I

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000227129
AA Change: K162I

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000227661
AA Change: K162I

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000228280
AA Change: K162I

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000228793
AA Change: K162I

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Other mutations in Vmn1r176
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Vmn1r176 APN 7 23835624 missense probably benign 0.04
IGL03004:Vmn1r176 APN 7 23835277 missense probably damaging 1.00
PIT4151001:Vmn1r176 UTSW 7 23835383 missense probably damaging 1.00
R0195:Vmn1r176 UTSW 7 23835585 missense probably benign 0.10
R1186:Vmn1r176 UTSW 7 23835626 missense probably damaging 1.00
R1531:Vmn1r176 UTSW 7 23835111 missense possibly damaging 0.95
R1680:Vmn1r176 UTSW 7 23835381 missense probably damaging 0.99
R1770:Vmn1r176 UTSW 7 23835521 missense probably benign 0.06
R1803:Vmn1r176 UTSW 7 23835184 missense probably damaging 1.00
R1970:Vmn1r176 UTSW 7 23834948 missense probably benign 0.01
R2092:Vmn1r176 UTSW 7 23835153 missense probably damaging 1.00
R4832:Vmn1r176 UTSW 7 23835038 missense possibly damaging 0.67
R5712:Vmn1r176 UTSW 7 23835500 missense probably benign 0.00
R6965:Vmn1r176 UTSW 7 23835674 missense possibly damaging 0.78
R7105:Vmn1r176 UTSW 7 23835323 nonsense probably null
R7839:Vmn1r176 UTSW 7 23834969 missense possibly damaging 0.91
R8262:Vmn1r176 UTSW 7 23835453 missense probably benign 0.29
Z1088:Vmn1r176 UTSW 7 23835173 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTCAGCATGAACTCTGAGC -3'
(R):5'- GTACAAACATGTGCTCCACC -3'

Sequencing Primer
(F):5'- AGCATGAACTCTGAGCTTCTG -3'
(R):5'- AAACATGTGCTCCACCTGCTC -3'
Posted On2015-04-02