Incidental Mutation 'R3498:Sec1'
ID273659
Institutional Source Beutler Lab
Gene Symbol Sec1
Ensembl Gene ENSMUSG00000040364
Gene Namesecretory blood group 1
SynonymsFut3, GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase FUT-III
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45677686-45694402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45679239 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 128 (H128R)
Ref Sequence ENSEMBL: ENSMUSP00000045229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040636] [ENSMUST00000182750]
Predicted Effect probably damaging
Transcript: ENSMUST00000040636
AA Change: H128R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045229
Gene: ENSMUSG00000040364
AA Change: H128R

DomainStartEndE-ValueType
Pfam:Glyco_transf_11 55 362 1.6e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182750
SMART Domains Protein: ENSMUSP00000138412
Gene: ENSMUSG00000070564

DomainStartEndE-ValueType
EGF_Lam 41 93 4.1e-2 SMART
EGF_Lam 96 156 3.59e-7 SMART
EGF_Lam 159 206 1.75e-10 SMART
low complexity region 212 220 N/A INTRINSIC
C345C 244 363 4.71e-23 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. This gene is predicted to encode a type II membrane protein, which is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Sec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0034:Sec1 UTSW 7 45679335 missense probably benign 0.00
R0076:Sec1 UTSW 7 45678891 missense probably damaging 1.00
R0076:Sec1 UTSW 7 45678891 missense probably damaging 1.00
R1716:Sec1 UTSW 7 45679365 missense probably benign 0.00
R1780:Sec1 UTSW 7 45678832 missense probably benign 0.00
R4634:Sec1 UTSW 7 45678873 missense probably damaging 1.00
R4822:Sec1 UTSW 7 45679303 missense probably damaging 1.00
R5384:Sec1 UTSW 7 45678840 missense probably benign 0.12
R7371:Sec1 UTSW 7 45678610 missense probably damaging 1.00
R7417:Sec1 UTSW 7 45684725 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGGGTGAACTCCTTCAG -3'
(R):5'- TAGGAGACTTGCAACCCTGC -3'

Sequencing Primer
(F):5'- AGGGTGAACTCCTTCAGGATCTC -3'
(R):5'- ACAGTGCTCCAGCGACTCAG -3'
Posted On2015-04-02