Incidental Mutation 'R3498:Kcnj11'
ID273660
Institutional Source Beutler Lab
Gene Symbol Kcnj11
Ensembl Gene ENSMUSG00000096146
Gene Namepotassium inwardly rectifying channel, subfamily J, member 11
SynonymsKir6.2
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46093953-46100764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46099602 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 23 (D23G)
Ref Sequence ENSEMBL: ENSMUSP00000147801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123] [ENSMUST00000180081] [ENSMUST00000209291] [ENSMUST00000209881] [ENSMUST00000211674]
Predicted Effect probably benign
Transcript: ENSMUST00000033123
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000180081
AA Change: D12G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136002
Gene: ENSMUSG00000096146
AA Change: D12G

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Pfam:IRK 36 360 4.9e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209291
AA Change: D23G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209863
Predicted Effect probably benign
Transcript: ENSMUST00000209881
AA Change: D42G

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210637
Predicted Effect probably benign
Transcript: ENSMUST00000210655
Predicted Effect probably benign
Transcript: ENSMUST00000210770
Predicted Effect possibly damaging
Transcript: ENSMUST00000211674
AA Change: D99G

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.9630 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and is found associated with the sulfonylurea receptor SUR. Mutations in this gene are a cause of familial persistent hyperinsulinemic hypoglycemia of infancy (PHHI), an autosomal recessive disorder characterized by unregulated insulin secretion. Defects in this gene may also contribute to autosomal dominant non-insulin-dependent diabetes mellitus type II (NIDDM), transient neonatal diabetes mellitus type 3 (TNDM3), and permanent neonatal diabetes mellitus (PNDM). Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired insulin secretion, mild glucose intolerance, reduced glucagon secretion in response to hypoglycemia, hypoxia-induced seizure susceptibility, and stress-induced arrhythmia and sudden death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Kcnj11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Kcnj11 APN 7 46098769 missense probably benign 0.02
IGL01767:Kcnj11 APN 7 46099065 missense probably benign 0.05
IGL01950:Kcnj11 APN 7 46099149 missense probably damaging 1.00
IGL02388:Kcnj11 APN 7 46099789 missense probably benign 0.22
R0019:Kcnj11 UTSW 7 46098939 missense probably benign 0.34
R0710:Kcnj11 UTSW 7 46099125 missense probably benign 0.00
R1216:Kcnj11 UTSW 7 46099861 missense probably benign 0.00
R1819:Kcnj11 UTSW 7 46099156 missense probably benign
R2155:Kcnj11 UTSW 7 46099357 missense probably damaging 1.00
R3148:Kcnj11 UTSW 7 46099120 missense probably benign 0.00
R4128:Kcnj11 UTSW 7 46099719 missense probably damaging 1.00
R4766:Kcnj11 UTSW 7 46099816 missense probably benign
R4926:Kcnj11 UTSW 7 46099120 missense probably benign 0.00
R5680:Kcnj11 UTSW 7 46098808 missense probably benign
R5708:Kcnj11 UTSW 7 46099818 missense probably benign 0.00
R7487:Kcnj11 UTSW 7 46098841 missense probably benign 0.01
R7788:Kcnj11 UTSW 7 46099755 missense probably damaging 1.00
R7816:Kcnj11 UTSW 7 46099857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGAAGATGCAGCCCAG -3'
(R):5'- TTCGTGTCCAAGAAAGGCAAC -3'

Sequencing Primer
(F):5'- CATGATGGCGTTGATCATCAGCC -3'
(R):5'- GCAACTGCAACGTCGCC -3'
Posted On2015-04-02