Incidental Mutation 'R3498:Pcid2'
ID 273662
Institutional Source Beutler Lab
Gene Symbol Pcid2
Ensembl Gene ENSMUSG00000038542
Gene Name PCI domain containing 2
Synonyms A730042J05Rik
MMRRC Submission 040661-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3498 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 13127189-13155459 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13150413 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 13 (V13A)
Ref Sequence ENSEMBL: ENSMUSP00000128207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164416] [ENSMUST00000168164] [ENSMUST00000172443]
AlphaFold Q8BFV2
Predicted Effect probably benign
Transcript: ENSMUST00000164416
AA Change: V13A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000133204
Gene: ENSMUSG00000038542
AA Change: V13A

DomainStartEndE-ValueType
PAM 144 312 4.29e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166881
Predicted Effect probably benign
Transcript: ENSMUST00000167198
Predicted Effect possibly damaging
Transcript: ENSMUST00000168164
AA Change: V13A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000172443
AA Change: V13A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.4283 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the TREX-2 complex (transcription and export complex 2), which regulates mRNA export from the nucleus. This protein regulates expression of Mad2 mitotic arrest deficient-like 1, a cell division checkpoint protein. This protein also interacts with and stabilizes Brca2 (breast cancer 2) protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygotes for a targeted null mutation implant, but die prior to embryonic day 7.5. Heterozygotes also exhibit excess embryonic loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,649,350 (GRCm39) F6L probably benign Het
Aurkc A G 7: 7,003,029 (GRCm39) I175V probably damaging Het
Azi2 A G 9: 117,878,475 (GRCm39) D105G probably damaging Het
Bcat1 A G 6: 144,965,068 (GRCm39) V45A probably damaging Het
Cass4 C T 2: 172,274,478 (GRCm39) P753L probably damaging Het
Cimip3 AC A 17: 47,744,348 (GRCm39) probably benign Het
Ddx42 A G 11: 106,122,019 (GRCm39) E178G possibly damaging Het
Dmpk T C 7: 18,820,306 (GRCm39) I101T probably damaging Het
Dnah17 C T 11: 117,971,675 (GRCm39) probably benign Het
Fosb C T 7: 19,040,557 (GRCm39) R161H probably damaging Het
Gm6729 T C 10: 86,376,582 (GRCm39) noncoding transcript Het
Gnb1 T A 4: 155,639,483 (GRCm39) N237K possibly damaging Het
Gpr35 A G 1: 92,911,113 (GRCm39) Y275C probably damaging Het
Hmcn1 A T 1: 150,480,853 (GRCm39) I4441N probably damaging Het
Ighe G A 12: 113,234,994 (GRCm39) Q389* probably null Het
Kcnj11 T C 7: 45,749,026 (GRCm39) D23G probably damaging Het
Lats2 G T 14: 57,959,923 (GRCm39) A191E possibly damaging Het
Lyplal1 A G 1: 185,820,857 (GRCm39) S197P possibly damaging Het
Map4 G T 9: 109,864,280 (GRCm39) V502L probably benign Het
Mgat5 A G 1: 127,312,571 (GRCm39) M237V possibly damaging Het
Mindy4 A G 6: 55,193,510 (GRCm39) R68G probably benign Het
Nell1 T A 7: 49,907,927 (GRCm39) V362E possibly damaging Het
Or5m8 T A 2: 85,822,774 (GRCm39) F204L probably benign Het
Or6c66b T A 10: 129,376,778 (GRCm39) I124N probably damaging Het
P4ha2 T C 11: 54,010,079 (GRCm39) Y279H probably benign Het
Polr2j T C 5: 136,151,624 (GRCm39) I116T probably benign Het
Prdm9 A G 17: 15,783,207 (GRCm39) probably benign Het
Prr5 T A 15: 84,587,345 (GRCm39) V365E probably benign Het
Ptprf A T 4: 118,082,127 (GRCm39) I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,169,203 (GRCm39) probably benign Het
Sde2 T A 1: 180,685,750 (GRCm39) C101S probably damaging Het
Sec1 T C 7: 45,328,663 (GRCm39) H128R probably damaging Het
Serpinb6a A T 13: 34,102,764 (GRCm39) M253K probably damaging Het
Slc1a4 A T 11: 20,263,973 (GRCm39) I248N probably damaging Het
Slc22a4 T G 11: 53,882,879 (GRCm39) K328N probably benign Het
Slc24a4 A T 12: 102,200,951 (GRCm39) K278N probably benign Het
Slc6a21 T A 7: 44,930,266 (GRCm39) W222R probably damaging Het
Slc7a2 A G 8: 41,365,567 (GRCm39) E466G probably benign Het
Sspo A G 6: 48,444,914 (GRCm39) T2133A possibly damaging Het
Taco1 A G 11: 105,963,364 (GRCm39) M172V probably benign Het
Tmem127 T A 2: 127,098,040 (GRCm39) H36Q probably benign Het
Tmem229b-ps C T 10: 53,351,223 (GRCm39) noncoding transcript Het
Vac14 A G 8: 111,397,722 (GRCm39) D479G probably benign Het
Vmn1r176 T A 7: 23,534,667 (GRCm39) K162I probably benign Het
Other mutations in Pcid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Pcid2 APN 8 13,140,660 (GRCm39) missense probably damaging 1.00
IGL01526:Pcid2 APN 8 13,135,319 (GRCm39) unclassified probably benign
IGL01603:Pcid2 APN 8 13,129,936 (GRCm39) missense possibly damaging 0.49
IGL01867:Pcid2 APN 8 13,128,243 (GRCm39) missense probably benign 0.06
raton UTSW 8 13,135,425 (GRCm39) missense probably damaging 1.00
R0091:Pcid2 UTSW 8 13,135,392 (GRCm39) missense probably benign 0.00
R0322:Pcid2 UTSW 8 13,140,775 (GRCm39) intron probably benign
R0403:Pcid2 UTSW 8 13,135,367 (GRCm39) missense probably damaging 1.00
R0426:Pcid2 UTSW 8 13,131,262 (GRCm39) critical splice donor site probably null
R1914:Pcid2 UTSW 8 13,144,141 (GRCm39) critical splice donor site probably null
R4432:Pcid2 UTSW 8 13,135,421 (GRCm39) missense probably damaging 0.99
R4832:Pcid2 UTSW 8 13,135,425 (GRCm39) missense probably damaging 1.00
R5106:Pcid2 UTSW 8 13,129,648 (GRCm39) missense probably damaging 1.00
R5169:Pcid2 UTSW 8 13,129,632 (GRCm39) splice site probably null
R5788:Pcid2 UTSW 8 13,150,320 (GRCm39) splice site probably null
R7048:Pcid2 UTSW 8 13,128,243 (GRCm39) missense probably benign 0.06
R7219:Pcid2 UTSW 8 13,129,907 (GRCm39) missense probably benign 0.01
R8322:Pcid2 UTSW 8 13,128,555 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCCTGTATATAGCCCTTCC -3'
(R):5'- CTTAGGAGTGAACTGCCCTG -3'

Sequencing Primer
(F):5'- GTATATAGCCCTTCCTATCTGCAG -3'
(R):5'- ACCTTGGGGGACTCTGTCTTAC -3'
Posted On 2015-04-02