Incidental Mutation 'R3498:Pcid2'
ID273662
Institutional Source Beutler Lab
Gene Symbol Pcid2
Ensembl Gene ENSMUSG00000038542
Gene NamePCI domain containing 2
Synonyms
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13077189-13105459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13100413 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 13 (V13A)
Ref Sequence ENSEMBL: ENSMUSP00000128207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164416] [ENSMUST00000168164] [ENSMUST00000172443]
Predicted Effect probably benign
Transcript: ENSMUST00000164416
AA Change: V13A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000133204
Gene: ENSMUSG00000038542
AA Change: V13A

DomainStartEndE-ValueType
PAM 144 312 4.29e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166881
Predicted Effect probably benign
Transcript: ENSMUST00000167198
Predicted Effect possibly damaging
Transcript: ENSMUST00000168164
AA Change: V13A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000172443
AA Change: V13A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.4283 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the TREX-2 complex (transcription and export complex 2), which regulates mRNA export from the nucleus. This protein regulates expression of Mad2 mitotic arrest deficient-like 1, a cell division checkpoint protein. This protein also interacts with and stabilizes Brca2 (breast cancer 2) protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygotes for a targeted null mutation implant, but die prior to embryonic day 7.5. Heterozygotes also exhibit excess embryonic loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Pcid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Pcid2 APN 8 13090660 missense probably damaging 1.00
IGL01526:Pcid2 APN 8 13085319 unclassified probably benign
IGL01603:Pcid2 APN 8 13079936 missense possibly damaging 0.49
IGL01867:Pcid2 APN 8 13078243 missense probably benign 0.06
raton UTSW 8 13085425 missense probably damaging 1.00
R0091:Pcid2 UTSW 8 13085392 missense probably benign 0.00
R0322:Pcid2 UTSW 8 13090775 intron probably benign
R0403:Pcid2 UTSW 8 13085367 missense probably damaging 1.00
R0426:Pcid2 UTSW 8 13081262 critical splice donor site probably null
R1914:Pcid2 UTSW 8 13094141 critical splice donor site probably null
R4432:Pcid2 UTSW 8 13085421 missense probably damaging 0.99
R4832:Pcid2 UTSW 8 13085425 missense probably damaging 1.00
R5106:Pcid2 UTSW 8 13079648 missense probably damaging 1.00
R5169:Pcid2 UTSW 8 13079632 splice site probably null
R5788:Pcid2 UTSW 8 13100320 splice site probably null
R7048:Pcid2 UTSW 8 13078243 missense probably benign 0.06
R7219:Pcid2 UTSW 8 13079907 missense probably benign 0.01
R8322:Pcid2 UTSW 8 13078555 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCCTGTATATAGCCCTTCC -3'
(R):5'- CTTAGGAGTGAACTGCCCTG -3'

Sequencing Primer
(F):5'- GTATATAGCCCTTCCTATCTGCAG -3'
(R):5'- ACCTTGGGGGACTCTGTCTTAC -3'
Posted On2015-04-02