Mutagenetix > Incidental Mutation

Incidental Mutation 'R3498:Slc7a2'

273663

Institutional Source

Beutler Lab

Gene Symbol

Slc7a2

Ensembl Gene

ENSMUSG00000031596

Gene Name

solute carrier family 7 (cationic amino acid transporter, y+ system), member 2

Synonyms

Tea, Cat2, Atrc2

MMRRC Submission

040661-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3498 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40862396-40922308 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40912530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 466 (E466G)

Ref Sequence

ENSEMBL: ENSMUSP00000112848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057784] [ENSMUST00000098816] [ENSMUST00000117077] [ENSMUST00000118432]

AlphaFold

P18581

Predicted Effect

probably benign
Transcript: ENSMUST00000057784
AA Change: E449G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000058866
Gene: ENSMUSG00000031596
AA Change: E449G

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	34	450	1.4e-55	PFAM
Pfam:AA_permease	38	442	9.7e-38	PFAM
transmembrane domain	492	514	N/A	INTRINSIC
transmembrane domain	524	543	N/A	INTRINSIC
Pfam:AA_permease_C	555	605	4.2e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098816
AA Change: E450G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000096414
Gene: ENSMUSG00000031596
AA Change: E450G

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	34	451	8.9e-54	PFAM
Pfam:AA_permease	38	443	5.8e-35	PFAM
transmembrane domain	493	515	N/A	INTRINSIC
transmembrane domain	525	544	N/A	INTRINSIC
Pfam:AA_permease_C	556	606	4.1e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117077
AA Change: E450G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000113729
Gene: ENSMUSG00000031596
AA Change: E450G

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	34	454	2e-52	PFAM
Pfam:AA_permease	38	440	4.8e-33	PFAM
transmembrane domain	493	515	N/A	INTRINSIC
transmembrane domain	525	544	N/A	INTRINSIC
Pfam:AA_permease_C	556	606	3e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118432
AA Change: E466G

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000112848
Gene: ENSMUSG00000031596
AA Change: E466G

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:AA_permease_2	51	469	5.1e-54	PFAM
Pfam:AA_permease	55	456	5.1e-36	PFAM
transmembrane domain	509	531	N/A	INTRINSIC
transmembrane domain	541	560	N/A	INTRINSIC
Pfam:AA_permease_C	572	622	2.5e-28	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cationic amino acid transporter and a member of the APC (amino acid-polyamine-organocation) family of transporters. The encoded membrane protein is responsible for the cellular uptake of arginine, lysine and ornithine. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a marked reduction of nitric oxide production by cytokine-activated macrophages. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
A3galt2	T	C	4: 128,755,557	F6L	probably benign	Het
Aurkc	A	G	7: 7,000,030	I175V	probably damaging	Het
Azi2	A	G	9: 118,049,407	D105G	probably damaging	Het
Bcat1	A	G	6: 145,019,342	V45A	probably damaging	Het
Cass4	C	T	2: 172,432,558	P753L	probably damaging	Het
Ddx42	A	G	11: 106,231,193	E178G	possibly damaging	Het
Dmpk	T	C	7: 19,086,381	I101T	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Fosb	C	T	7: 19,306,632	R161H	probably damaging	Het
Gm6729	T	C	10: 86,540,718		noncoding transcript	Het
Gnb1	T	A	4: 155,555,026	N237K	possibly damaging	Het
Gpr35	A	G	1: 92,983,391	Y275C	probably damaging	Het
Hmcn1	A	T	1: 150,605,102	I4441N	probably damaging	Het
Ighe	G	A	12: 113,271,374	Q389*	probably null	Het
Kcnj11	T	C	7: 46,099,602	D23G	probably damaging	Het
Lats2	G	T	14: 57,722,466	A191E	possibly damaging	Het
Lyplal1	A	G	1: 186,088,660	S197P	possibly damaging	Het
Map4	G	T	9: 110,035,212	V502L	probably benign	Het
Mgat5	A	G	1: 127,384,834	M237V	possibly damaging	Het
Mindy4	A	G	6: 55,216,525	R68G	probably benign	Het
Nell1	T	A	7: 50,258,179	V362E	possibly damaging	Het
Olfr1031	T	A	2: 85,992,430	F204L	probably benign	Het
Olfr792	T	A	10: 129,540,909	I124N	probably damaging	Het
P4ha2	T	C	11: 54,119,253	Y279H	probably benign	Het
Pcid2	A	G	8: 13,100,413	V13A	possibly damaging	Het
Polr2j	T	C	5: 136,122,770	I116T	probably benign	Het
Prdm9	A	G	17: 15,562,945		probably benign	Het
Prr5	T	A	15: 84,703,144	V365E	probably benign	Het
Ptprf	A	T	4: 118,224,930	I1037N	probably damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Sde2	T	A	1: 180,858,185	C101S	probably damaging	Het
Sec1	T	C	7: 45,679,239	H128R	probably damaging	Het
Serpinb6a	A	T	13: 33,918,781	M253K	probably damaging	Het
Slc1a4	A	T	11: 20,313,973	I248N	probably damaging	Het
Slc22a4	T	G	11: 53,992,053	K328N	probably benign	Het
Slc24a4	A	T	12: 102,234,692	K278N	probably benign	Het
Slc6a21	T	A	7: 45,280,842	W222R	probably damaging	Het
Sspo	A	G	6: 48,467,980	T2133A	possibly damaging	Het
Taco1	A	G	11: 106,072,538	M172V	probably benign	Het
Tmem127	T	A	2: 127,256,120	H36Q	probably benign	Het
Tmem229b-ps	C	T	10: 53,475,127		noncoding transcript	Het
Vac14	A	G	8: 110,671,090	D479G	probably benign	Het
Vmn1r176	T	A	7: 23,835,242	K162I	probably benign	Het

Other mutations in Slc7a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Slc7a2	APN	8	40905622	missense	possibly damaging	0.57
IGL00948:Slc7a2	APN	8	40912524	missense	probably benign	0.04
IGL01565:Slc7a2	APN	8	40899238	missense	possibly damaging	0.94
IGL01590:Slc7a2	APN	8	40914100	missense	probably damaging	1.00
IGL01939:Slc7a2	APN	8	40914083	missense	possibly damaging	0.93
IGL02043:Slc7a2	APN	8	40911058	missense	probably benign	0.35
IGL02101:Slc7a2	APN	8	40902594	missense	probably benign	0.07
IGL02238:Slc7a2	APN	8	40908156	missense	probably benign
IGL02385:Slc7a2	APN	8	40899011	missense	probably damaging	0.98
IGL02562:Slc7a2	APN	8	40915020	missense	probably damaging	1.00
IGL02962:Slc7a2	APN	8	40905584	missense	probably damaging	0.98
IGL03268:Slc7a2	APN	8	40912517	missense	probably benign	0.00
IGL03285:Slc7a2	APN	8	40914993	missense	possibly damaging	0.50
IGL03345:Slc7a2	APN	8	40916493	missense	probably benign	0.25
IGL03375:Slc7a2	APN	8	40916373	missense	probably damaging	1.00
R0014:Slc7a2	UTSW	8	40911028	missense	probably damaging	1.00
R0014:Slc7a2	UTSW	8	40911028	missense	probably damaging	1.00
R0437:Slc7a2	UTSW	8	40904526	missense	probably damaging	1.00
R0624:Slc7a2	UTSW	8	40908531	missense	probably benign	0.34
R1406:Slc7a2	UTSW	8	40905585	missense	probably damaging	1.00
R1406:Slc7a2	UTSW	8	40905585	missense	probably damaging	1.00
R1908:Slc7a2	UTSW	8	40916497	missense	probably benign
R1959:Slc7a2	UTSW	8	40914965	missense	probably damaging	0.97
R2251:Slc7a2	UTSW	8	40905621	missense	probably benign	0.19
R2252:Slc7a2	UTSW	8	40905621	missense	probably benign	0.19
R2253:Slc7a2	UTSW	8	40905621	missense	probably benign	0.19
R3899:Slc7a2	UTSW	8	40905553	missense	possibly damaging	0.93
R4440:Slc7a2	UTSW	8	40902649	missense	probably benign
R4785:Slc7a2	UTSW	8	40911058	missense	probably benign	0.18
R4788:Slc7a2	UTSW	8	40913986	missense	probably benign
R4826:Slc7a2	UTSW	8	40911046	missense	probably damaging	1.00
R4996:Slc7a2	UTSW	8	40912562	nonsense	probably null
R5249:Slc7a2	UTSW	8	40908093	missense	possibly damaging	0.77
R5314:Slc7a2	UTSW	8	40915030	critical splice donor site	probably null
R5408:Slc7a2	UTSW	8	40915005	missense	probably damaging	1.00
R5537:Slc7a2	UTSW	8	40913986	missense	probably benign	0.10
R6116:Slc7a2	UTSW	8	40900169	missense	probably damaging	0.98
R7139:Slc7a2	UTSW	8	40915013	missense	probably benign	0.01
R7389:Slc7a2	UTSW	8	40912515	missense	probably benign
R7451:Slc7a2	UTSW	8	40912649	missense	probably damaging	0.99
R7979:Slc7a2	UTSW	8	40904504	missense	probably damaging	1.00
R8415:Slc7a2	UTSW	8	40916359	missense	probably damaging	1.00
R8673:Slc7a2	UTSW	8	40912409	intron	probably benign
R8705:Slc7a2	UTSW	8	40914995	missense	probably damaging	1.00
R8770:Slc7a2	UTSW	8	40899230	missense	probably damaging	1.00
R8777:Slc7a2	UTSW	8	40898954	missense	probably damaging	1.00
R8777-TAIL:Slc7a2	UTSW	8	40898954	missense	probably damaging	1.00
R9118:Slc7a2	UTSW	8	40898957	missense	possibly damaging	0.49
R9139:Slc7a2	UTSW	8	40905672	missense	probably damaging	1.00
R9458:Slc7a2	UTSW	8	40899293	missense	probably damaging	1.00
R9776:Slc7a2	UTSW	8	40905604	missense	probably damaging	1.00
X0062:Slc7a2	UTSW	8	40914963	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGTAGCCTGGCTCAGCAC -3'
(R):5'- GTTGGGCCTTTCAACATCTGC -3'

Sequencing Primer
(F):5'- CATTGGAATCATGAGAAGTGTCACCC -3'
(R):5'- TGCTGTCAAGACTTACCCAGG -3'

Posted On

2015-04-02