Incidental Mutation 'R3498:Slc7a2'
ID273663
Institutional Source Beutler Lab
Gene Symbol Slc7a2
Ensembl Gene ENSMUSG00000031596
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 2
SynonymsTea, Cat2, Atrc2
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location40862396-40922308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40912530 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 466 (E466G)
Ref Sequence ENSEMBL: ENSMUSP00000112848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057784] [ENSMUST00000098816] [ENSMUST00000117077] [ENSMUST00000118432]
Predicted Effect probably benign
Transcript: ENSMUST00000057784
AA Change: E449G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000058866
Gene: ENSMUSG00000031596
AA Change: E449G

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 450 1.4e-55 PFAM
Pfam:AA_permease 38 442 9.7e-38 PFAM
transmembrane domain 492 514 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:AA_permease_C 555 605 4.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098816
AA Change: E450G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096414
Gene: ENSMUSG00000031596
AA Change: E450G

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 451 8.9e-54 PFAM
Pfam:AA_permease 38 443 5.8e-35 PFAM
transmembrane domain 493 515 N/A INTRINSIC
transmembrane domain 525 544 N/A INTRINSIC
Pfam:AA_permease_C 556 606 4.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117077
AA Change: E450G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113729
Gene: ENSMUSG00000031596
AA Change: E450G

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 454 2e-52 PFAM
Pfam:AA_permease 38 440 4.8e-33 PFAM
transmembrane domain 493 515 N/A INTRINSIC
transmembrane domain 525 544 N/A INTRINSIC
Pfam:AA_permease_C 556 606 3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118432
AA Change: E466G

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112848
Gene: ENSMUSG00000031596
AA Change: E466G

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:AA_permease_2 51 469 5.1e-54 PFAM
Pfam:AA_permease 55 456 5.1e-36 PFAM
transmembrane domain 509 531 N/A INTRINSIC
transmembrane domain 541 560 N/A INTRINSIC
Pfam:AA_permease_C 572 622 2.5e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cationic amino acid transporter and a member of the APC (amino acid-polyamine-organocation) family of transporters. The encoded membrane protein is responsible for the cellular uptake of arginine, lysine and ornithine. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a marked reduction of nitric oxide production by cytokine-activated macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Slc7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Slc7a2 APN 8 40905622 missense possibly damaging 0.57
IGL00948:Slc7a2 APN 8 40912524 missense probably benign 0.04
IGL01565:Slc7a2 APN 8 40899238 missense possibly damaging 0.94
IGL01590:Slc7a2 APN 8 40914100 missense probably damaging 1.00
IGL01939:Slc7a2 APN 8 40914083 missense possibly damaging 0.93
IGL02043:Slc7a2 APN 8 40911058 missense probably benign 0.35
IGL02101:Slc7a2 APN 8 40902594 missense probably benign 0.07
IGL02238:Slc7a2 APN 8 40908156 missense probably benign
IGL02385:Slc7a2 APN 8 40899011 missense probably damaging 0.98
IGL02562:Slc7a2 APN 8 40915020 missense probably damaging 1.00
IGL02962:Slc7a2 APN 8 40905584 missense probably damaging 0.98
IGL03268:Slc7a2 APN 8 40912517 missense probably benign 0.00
IGL03285:Slc7a2 APN 8 40914993 missense possibly damaging 0.50
IGL03345:Slc7a2 APN 8 40916493 missense probably benign 0.25
IGL03375:Slc7a2 APN 8 40916373 missense probably damaging 1.00
R0014:Slc7a2 UTSW 8 40911028 missense probably damaging 1.00
R0014:Slc7a2 UTSW 8 40911028 missense probably damaging 1.00
R0437:Slc7a2 UTSW 8 40904526 missense probably damaging 1.00
R0624:Slc7a2 UTSW 8 40908531 missense probably benign 0.34
R1406:Slc7a2 UTSW 8 40905585 missense probably damaging 1.00
R1406:Slc7a2 UTSW 8 40905585 missense probably damaging 1.00
R1908:Slc7a2 UTSW 8 40916497 missense probably benign
R1959:Slc7a2 UTSW 8 40914965 missense probably damaging 0.97
R2251:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R2252:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R2253:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R3899:Slc7a2 UTSW 8 40905553 missense possibly damaging 0.93
R4440:Slc7a2 UTSW 8 40902649 missense probably benign
R4785:Slc7a2 UTSW 8 40911058 missense probably benign 0.18
R4788:Slc7a2 UTSW 8 40913986 missense probably benign
R4826:Slc7a2 UTSW 8 40911046 missense probably damaging 1.00
R4996:Slc7a2 UTSW 8 40912562 nonsense probably null
R5249:Slc7a2 UTSW 8 40908093 missense possibly damaging 0.77
R5314:Slc7a2 UTSW 8 40915030 critical splice donor site probably null
R5408:Slc7a2 UTSW 8 40915005 missense probably damaging 1.00
R5537:Slc7a2 UTSW 8 40913986 missense probably benign 0.10
R6116:Slc7a2 UTSW 8 40900169 missense probably damaging 0.98
R7139:Slc7a2 UTSW 8 40915013 missense probably benign 0.01
R7389:Slc7a2 UTSW 8 40912515 missense probably benign
R7451:Slc7a2 UTSW 8 40912649 missense probably damaging 0.99
R7979:Slc7a2 UTSW 8 40904504 missense probably damaging 1.00
R8415:Slc7a2 UTSW 8 40916359 missense not run
X0062:Slc7a2 UTSW 8 40914963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTAGCCTGGCTCAGCAC -3'
(R):5'- GTTGGGCCTTTCAACATCTGC -3'

Sequencing Primer
(F):5'- CATTGGAATCATGAGAAGTGTCACCC -3'
(R):5'- TGCTGTCAAGACTTACCCAGG -3'
Posted On2015-04-02