Mutagenetix > Incidental Mutation

Incidental Mutation 'R3498:Vac14'

273664

Institutional Source

Beutler Lab

Gene Symbol

Vac14

Ensembl Gene

ENSMUSG00000010936

Gene Name

Vac14 homolog (S. cerevisiae)

Synonyms

Tax1bp2, ingls, D8Wsu151e, Trx

MMRRC Submission

040661-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3498 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110618585-110720398 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110671090 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 479 (D479G)

Ref Sequence

ENSEMBL: ENSMUSP00000034190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034190] [ENSMUST00000212829] [ENSMUST00000213003]

AlphaFold

Q80WQ2

Predicted Effect

probably benign
Transcript: ENSMUST00000034190
AA Change: D479G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000034190
Gene: ENSMUSG00000010936
AA Change: D479G

Domain	Start	End	E-Value	Type
Pfam:Vac14_Fab1_bd	67	163	5.3e-43	PFAM
Pfam:Vac14_Fig4_bd	542	720	6.6e-82	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212663

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212766

Predicted Effect

probably benign
Transcript: ENSMUST00000212829

Predicted Effect

probably benign
Transcript: ENSMUST00000213003

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213015

Meta Mutation Damage Score

0.0727

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The content of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) in endosomal membranes changes dynamically with fission and fusion events that generate or absorb intracellular transport vesicles. VAC14 is a component of a trimolecular complex that tightly regulates the level of PtdIns(3,5)P2. Other components of this complex are the PtdIns(3,5)P2-synthesizing enzyme PIKFYVE (MIM 609414) and the PtdIns(3,5)P2 phosphatase FIG4 (MIM 609390). VAC14 functions as an activator of PIKFYVE (Sbrissa et al., 2007 [PubMed 17556371]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display early postnatal lethality with lesions in multiple regions of the brain. Mice homozygous for a hypomorphic allele exhibit postnatal lethality, spongiform degeneration, enlarged brain ventricles and coat color dilution. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
A3galt2	T	C	4: 128,755,557	F6L	probably benign	Het
Aurkc	A	G	7: 7,000,030	I175V	probably damaging	Het
Azi2	A	G	9: 118,049,407	D105G	probably damaging	Het
Bcat1	A	G	6: 145,019,342	V45A	probably damaging	Het
Cass4	C	T	2: 172,432,558	P753L	probably damaging	Het
Ddx42	A	G	11: 106,231,193	E178G	possibly damaging	Het
Dmpk	T	C	7: 19,086,381	I101T	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Fosb	C	T	7: 19,306,632	R161H	probably damaging	Het
Gm6729	T	C	10: 86,540,718		noncoding transcript	Het
Gnb1	T	A	4: 155,555,026	N237K	possibly damaging	Het
Gpr35	A	G	1: 92,983,391	Y275C	probably damaging	Het
Hmcn1	A	T	1: 150,605,102	I4441N	probably damaging	Het
Ighe	G	A	12: 113,271,374	Q389*	probably null	Het
Kcnj11	T	C	7: 46,099,602	D23G	probably damaging	Het
Lats2	G	T	14: 57,722,466	A191E	possibly damaging	Het
Lyplal1	A	G	1: 186,088,660	S197P	possibly damaging	Het
Map4	G	T	9: 110,035,212	V502L	probably benign	Het
Mgat5	A	G	1: 127,384,834	M237V	possibly damaging	Het
Mindy4	A	G	6: 55,216,525	R68G	probably benign	Het
Nell1	T	A	7: 50,258,179	V362E	possibly damaging	Het
Olfr1031	T	A	2: 85,992,430	F204L	probably benign	Het
Olfr792	T	A	10: 129,540,909	I124N	probably damaging	Het
P4ha2	T	C	11: 54,119,253	Y279H	probably benign	Het
Pcid2	A	G	8: 13,100,413	V13A	possibly damaging	Het
Polr2j	T	C	5: 136,122,770	I116T	probably benign	Het
Prdm9	A	G	17: 15,562,945		probably benign	Het
Prr5	T	A	15: 84,703,144	V365E	probably benign	Het
Ptprf	A	T	4: 118,224,930	I1037N	probably damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Sde2	T	A	1: 180,858,185	C101S	probably damaging	Het
Sec1	T	C	7: 45,679,239	H128R	probably damaging	Het
Serpinb6a	A	T	13: 33,918,781	M253K	probably damaging	Het
Slc1a4	A	T	11: 20,313,973	I248N	probably damaging	Het
Slc22a4	T	G	11: 53,992,053	K328N	probably benign	Het
Slc24a4	A	T	12: 102,234,692	K278N	probably benign	Het
Slc6a21	T	A	7: 45,280,842	W222R	probably damaging	Het
Slc7a2	A	G	8: 40,912,530	E466G	probably benign	Het
Sspo	A	G	6: 48,467,980	T2133A	possibly damaging	Het
Taco1	A	G	11: 106,072,538	M172V	probably benign	Het
Tmem127	T	A	2: 127,256,120	H36Q	probably benign	Het
Tmem229b-ps	C	T	10: 53,475,127		noncoding transcript	Het
Vmn1r176	T	A	7: 23,835,242	K162I	probably benign	Het

Other mutations in Vac14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01154:Vac14	APN	8	110653607	splice site	probably benign
IGL01511:Vac14	APN	8	110712798	missense	possibly damaging	0.93
IGL01724:Vac14	APN	8	110618891	start codon destroyed	probably null	1.00
IGL01784:Vac14	APN	8	110671168	missense	probably benign	0.00
IGL02086:Vac14	APN	8	110653318	missense	possibly damaging	0.74
IGL02447:Vac14	APN	8	110653628	missense	probably benign	0.39
IGL02614:Vac14	APN	8	110635118	missense	probably damaging	1.00
IGL03059:Vac14	APN	8	110710452	missense	probably damaging	1.00
IGL03155:Vac14	APN	8	110636343	missense	possibly damaging	0.90
Bathwater	UTSW	8	110711620	missense	probably damaging	1.00
ducky	UTSW	8	110636472	splice site	probably null
Rubber	UTSW	8	110671042	missense	probably damaging	1.00
R0045:Vac14	UTSW	8	110636952	missense	probably benign	0.00
R0045:Vac14	UTSW	8	110636952	missense	probably benign	0.00
R0239:Vac14	UTSW	8	110635375	critical splice acceptor site	probably null
R0239:Vac14	UTSW	8	110635375	critical splice acceptor site	probably null
R0718:Vac14	UTSW	8	110632477	missense	probably damaging	1.00
R1696:Vac14	UTSW	8	110632447	critical splice acceptor site	probably null
R1883:Vac14	UTSW	8	110711687	missense	probably damaging	1.00
R1884:Vac14	UTSW	8	110711687	missense	probably damaging	1.00
R1903:Vac14	UTSW	8	110682534	missense	probably benign	0.04
R2764:Vac14	UTSW	8	110710455	missense	probably damaging	1.00
R3000:Vac14	UTSW	8	110634317	missense	probably damaging	1.00
R4898:Vac14	UTSW	8	110645808	missense	probably benign
R5030:Vac14	UTSW	8	110710386	missense	possibly damaging	0.66
R5255:Vac14	UTSW	8	110634329	missense	probably damaging	0.99
R5918:Vac14	UTSW	8	110636472	splice site	probably null
R5930:Vac14	UTSW	8	110710349	missense	probably damaging	1.00
R7003:Vac14	UTSW	8	110712798	missense	probably damaging	0.99
R7092:Vac14	UTSW	8	110715496	missense	probably damaging	1.00
R7214:Vac14	UTSW	8	110671042	missense	probably damaging	1.00
R7327:Vac14	UTSW	8	110711620	missense	probably damaging	1.00
R7474:Vac14	UTSW	8	110636434	missense	probably damaging	1.00
R7741:Vac14	UTSW	8	110634388	missense	probably damaging	1.00
R8087:Vac14	UTSW	8	110719900	missense	probably benign
R8798:Vac14	UTSW	8	110719887	missense	probably benign	0.18
R8981:Vac14	UTSW	8	110711594	missense	probably damaging	0.99
R9051:Vac14	UTSW	8	110653237	missense	probably benign
R9319:Vac14	UTSW	8	110634386	missense	probably damaging	1.00
R9358:Vac14	UTSW	8	110712747	critical splice acceptor site	probably null
R9468:Vac14	UTSW	8	110671106	missense	probably benign	0.00
R9518:Vac14	UTSW	8	110715438	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATCTCTGTGGCTCTCGTGAC -3'
(R):5'- ACTGACTCTCATAAATGGCAGAAC -3'

Sequencing Primer
(F):5'- TCTCGTGACAGGCAAGCAG -3'
(R):5'- CACATTTATAAGTGACTTCCTGGGC -3'

Posted On

2015-04-02