Incidental Mutation 'R3498:Vac14'
ID273664
Institutional Source Beutler Lab
Gene Symbol Vac14
Ensembl Gene ENSMUSG00000010936
Gene NameVac14 homolog (S. cerevisiae)
SynonymsTax1bp2, ingls, D8Wsu151e, Trx
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110618585-110720398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110671090 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 479 (D479G)
Ref Sequence ENSEMBL: ENSMUSP00000034190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034190] [ENSMUST00000212829] [ENSMUST00000213003]
Predicted Effect probably benign
Transcript: ENSMUST00000034190
AA Change: D479G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034190
Gene: ENSMUSG00000010936
AA Change: D479G

DomainStartEndE-ValueType
Pfam:Vac14_Fab1_bd 67 163 5.3e-43 PFAM
Pfam:Vac14_Fig4_bd 542 720 6.6e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212766
Predicted Effect probably benign
Transcript: ENSMUST00000212829
Predicted Effect probably benign
Transcript: ENSMUST00000213003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213015
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The content of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) in endosomal membranes changes dynamically with fission and fusion events that generate or absorb intracellular transport vesicles. VAC14 is a component of a trimolecular complex that tightly regulates the level of PtdIns(3,5)P2. Other components of this complex are the PtdIns(3,5)P2-synthesizing enzyme PIKFYVE (MIM 609414) and the PtdIns(3,5)P2 phosphatase FIG4 (MIM 609390). VAC14 functions as an activator of PIKFYVE (Sbrissa et al., 2007 [PubMed 17556371]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display early postnatal lethality with lesions in multiple regions of the brain. Mice homozygous for a hypomorphic allele exhibit postnatal lethality, spongiform degeneration, enlarged brain ventricles and coat color dilution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Vac14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Vac14 APN 8 110653607 splice site probably benign
IGL01511:Vac14 APN 8 110712798 missense possibly damaging 0.93
IGL01724:Vac14 APN 8 110618891 start codon destroyed probably null 1.00
IGL01784:Vac14 APN 8 110671168 missense probably benign 0.00
IGL02086:Vac14 APN 8 110653318 missense possibly damaging 0.74
IGL02447:Vac14 APN 8 110653628 missense probably benign 0.39
IGL02614:Vac14 APN 8 110635118 missense probably damaging 1.00
IGL03059:Vac14 APN 8 110710452 missense probably damaging 1.00
IGL03155:Vac14 APN 8 110636343 missense possibly damaging 0.90
ducky UTSW 8 110636472 splice site probably null
Rubber UTSW 8 110671042 missense probably damaging 1.00
R0045:Vac14 UTSW 8 110636952 missense probably benign 0.00
R0045:Vac14 UTSW 8 110636952 missense probably benign 0.00
R0239:Vac14 UTSW 8 110635375 critical splice acceptor site probably null
R0239:Vac14 UTSW 8 110635375 critical splice acceptor site probably null
R0718:Vac14 UTSW 8 110632477 missense probably damaging 1.00
R1696:Vac14 UTSW 8 110632447 critical splice acceptor site probably null
R1883:Vac14 UTSW 8 110711687 missense probably damaging 1.00
R1884:Vac14 UTSW 8 110711687 missense probably damaging 1.00
R1903:Vac14 UTSW 8 110682534 missense probably benign 0.04
R2764:Vac14 UTSW 8 110710455 missense probably damaging 1.00
R3000:Vac14 UTSW 8 110634317 missense probably damaging 1.00
R4898:Vac14 UTSW 8 110645808 missense probably benign
R5030:Vac14 UTSW 8 110710386 missense possibly damaging 0.66
R5255:Vac14 UTSW 8 110634329 missense probably damaging 0.99
R5918:Vac14 UTSW 8 110636472 splice site probably null
R5930:Vac14 UTSW 8 110710349 missense probably damaging 1.00
R7003:Vac14 UTSW 8 110712798 missense probably damaging 0.99
R7092:Vac14 UTSW 8 110715496 missense probably damaging 1.00
R7214:Vac14 UTSW 8 110671042 missense probably damaging 1.00
R7327:Vac14 UTSW 8 110711620 missense probably damaging 1.00
R7474:Vac14 UTSW 8 110636434 missense probably damaging 1.00
R7741:Vac14 UTSW 8 110634388 missense probably damaging 1.00
R8087:Vac14 UTSW 8 110719900 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTCTGTGGCTCTCGTGAC -3'
(R):5'- ACTGACTCTCATAAATGGCAGAAC -3'

Sequencing Primer
(F):5'- TCTCGTGACAGGCAAGCAG -3'
(R):5'- CACATTTATAAGTGACTTCCTGGGC -3'
Posted On2015-04-02