Incidental Mutation 'R3498:Map4'
ID 273665
Institutional Source Beutler Lab
Gene Symbol Map4
Ensembl Gene ENSMUSG00000032479
Gene Name microtubule-associated protein 4
Synonyms MAP 4, Mtap4
MMRRC Submission 040661-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3498 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 109760528-109913023 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 109864280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 502 (V502L)
Ref Sequence ENSEMBL: ENSMUSP00000132662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000165876]
AlphaFold P27546
Predicted Effect probably benign
Transcript: ENSMUST00000035055
AA Change: V502L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479
AA Change: V502L

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163190
Predicted Effect probably benign
Transcript: ENSMUST00000165876
AA Change: V502L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479
AA Change: V502L

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Meta Mutation Damage Score 0.1040 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and do not display any overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,649,350 (GRCm39) F6L probably benign Het
Aurkc A G 7: 7,003,029 (GRCm39) I175V probably damaging Het
Azi2 A G 9: 117,878,475 (GRCm39) D105G probably damaging Het
Bcat1 A G 6: 144,965,068 (GRCm39) V45A probably damaging Het
Cass4 C T 2: 172,274,478 (GRCm39) P753L probably damaging Het
Cimip3 AC A 17: 47,744,348 (GRCm39) probably benign Het
Ddx42 A G 11: 106,122,019 (GRCm39) E178G possibly damaging Het
Dmpk T C 7: 18,820,306 (GRCm39) I101T probably damaging Het
Dnah17 C T 11: 117,971,675 (GRCm39) probably benign Het
Fosb C T 7: 19,040,557 (GRCm39) R161H probably damaging Het
Gm6729 T C 10: 86,376,582 (GRCm39) noncoding transcript Het
Gnb1 T A 4: 155,639,483 (GRCm39) N237K possibly damaging Het
Gpr35 A G 1: 92,911,113 (GRCm39) Y275C probably damaging Het
Hmcn1 A T 1: 150,480,853 (GRCm39) I4441N probably damaging Het
Ighe G A 12: 113,234,994 (GRCm39) Q389* probably null Het
Kcnj11 T C 7: 45,749,026 (GRCm39) D23G probably damaging Het
Lats2 G T 14: 57,959,923 (GRCm39) A191E possibly damaging Het
Lyplal1 A G 1: 185,820,857 (GRCm39) S197P possibly damaging Het
Mgat5 A G 1: 127,312,571 (GRCm39) M237V possibly damaging Het
Mindy4 A G 6: 55,193,510 (GRCm39) R68G probably benign Het
Nell1 T A 7: 49,907,927 (GRCm39) V362E possibly damaging Het
Or5m8 T A 2: 85,822,774 (GRCm39) F204L probably benign Het
Or6c66b T A 10: 129,376,778 (GRCm39) I124N probably damaging Het
P4ha2 T C 11: 54,010,079 (GRCm39) Y279H probably benign Het
Pcid2 A G 8: 13,150,413 (GRCm39) V13A possibly damaging Het
Polr2j T C 5: 136,151,624 (GRCm39) I116T probably benign Het
Prdm9 A G 17: 15,783,207 (GRCm39) probably benign Het
Prr5 T A 15: 84,587,345 (GRCm39) V365E probably benign Het
Ptprf A T 4: 118,082,127 (GRCm39) I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,169,203 (GRCm39) probably benign Het
Sde2 T A 1: 180,685,750 (GRCm39) C101S probably damaging Het
Sec1 T C 7: 45,328,663 (GRCm39) H128R probably damaging Het
Serpinb6a A T 13: 34,102,764 (GRCm39) M253K probably damaging Het
Slc1a4 A T 11: 20,263,973 (GRCm39) I248N probably damaging Het
Slc22a4 T G 11: 53,882,879 (GRCm39) K328N probably benign Het
Slc24a4 A T 12: 102,200,951 (GRCm39) K278N probably benign Het
Slc6a21 T A 7: 44,930,266 (GRCm39) W222R probably damaging Het
Slc7a2 A G 8: 41,365,567 (GRCm39) E466G probably benign Het
Sspo A G 6: 48,444,914 (GRCm39) T2133A possibly damaging Het
Taco1 A G 11: 105,963,364 (GRCm39) M172V probably benign Het
Tmem127 T A 2: 127,098,040 (GRCm39) H36Q probably benign Het
Tmem229b-ps C T 10: 53,351,223 (GRCm39) noncoding transcript Het
Vac14 A G 8: 111,397,722 (GRCm39) D479G probably benign Het
Vmn1r176 T A 7: 23,534,667 (GRCm39) K162I probably benign Het
Other mutations in Map4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Map4 APN 9 109,901,672 (GRCm39) splice site probably benign
IGL01331:Map4 APN 9 109,863,869 (GRCm39) missense probably benign 0.04
IGL01599:Map4 APN 9 109,863,836 (GRCm39) missense probably benign 0.26
IGL01631:Map4 APN 9 109,892,201 (GRCm39) unclassified probably benign
IGL02208:Map4 APN 9 109,807,938 (GRCm39) start codon destroyed probably null 1.00
IGL02455:Map4 APN 9 109,828,901 (GRCm39) missense probably benign 0.15
IGL02625:Map4 APN 9 109,893,485 (GRCm39) missense probably damaging 1.00
PIT4486001:Map4 UTSW 9 109,901,682 (GRCm39) missense probably damaging 1.00
R0149:Map4 UTSW 9 109,896,692 (GRCm39) missense probably damaging 0.96
R0384:Map4 UTSW 9 109,863,696 (GRCm39) missense probably damaging 0.99
R0392:Map4 UTSW 9 109,907,113 (GRCm39) missense probably damaging 1.00
R0496:Map4 UTSW 9 109,868,918 (GRCm39) intron probably benign
R0526:Map4 UTSW 9 109,866,346 (GRCm39) splice site probably null
R0555:Map4 UTSW 9 109,808,171 (GRCm39) splice site probably benign
R0571:Map4 UTSW 9 109,865,834 (GRCm39) missense probably benign 0.00
R0698:Map4 UTSW 9 109,897,856 (GRCm39) nonsense probably null
R0762:Map4 UTSW 9 109,867,546 (GRCm39) intron probably benign
R0862:Map4 UTSW 9 109,808,037 (GRCm39) missense probably damaging 1.00
R0864:Map4 UTSW 9 109,808,037 (GRCm39) missense probably damaging 1.00
R1168:Map4 UTSW 9 109,864,032 (GRCm39) missense probably benign 0.00
R1238:Map4 UTSW 9 109,897,648 (GRCm39) missense probably benign 0.00
R1735:Map4 UTSW 9 109,864,023 (GRCm39) missense probably benign 0.00
R1869:Map4 UTSW 9 109,897,996 (GRCm39) missense possibly damaging 0.95
R1869:Map4 UTSW 9 109,864,032 (GRCm39) missense probably benign 0.00
R2196:Map4 UTSW 9 109,900,116 (GRCm39) missense probably damaging 1.00
R2264:Map4 UTSW 9 109,910,525 (GRCm39) missense probably damaging 1.00
R2507:Map4 UTSW 9 109,866,551 (GRCm39) intron probably benign
R2512:Map4 UTSW 9 109,863,770 (GRCm39) missense possibly damaging 0.48
R3087:Map4 UTSW 9 109,882,257 (GRCm39) missense possibly damaging 0.84
R3154:Map4 UTSW 9 109,828,860 (GRCm39) missense probably benign 0.19
R3547:Map4 UTSW 9 109,881,266 (GRCm39) missense possibly damaging 0.61
R3751:Map4 UTSW 9 109,867,742 (GRCm39) intron probably benign
R4036:Map4 UTSW 9 109,861,283 (GRCm39) missense possibly damaging 0.47
R4423:Map4 UTSW 9 109,896,662 (GRCm39) missense probably damaging 1.00
R4505:Map4 UTSW 9 109,861,253 (GRCm39) missense probably benign 0.01
R4561:Map4 UTSW 9 109,881,439 (GRCm39) missense possibly damaging 0.91
R4577:Map4 UTSW 9 109,910,489 (GRCm39) missense possibly damaging 0.48
R4601:Map4 UTSW 9 109,881,887 (GRCm39) missense possibly damaging 0.75
R4795:Map4 UTSW 9 109,864,331 (GRCm39) missense probably benign 0.00
R4801:Map4 UTSW 9 109,864,325 (GRCm39) missense probably benign 0.15
R4802:Map4 UTSW 9 109,864,325 (GRCm39) missense probably benign 0.15
R4999:Map4 UTSW 9 109,867,445 (GRCm39) intron probably benign
R5020:Map4 UTSW 9 109,897,868 (GRCm39) missense probably benign 0.02
R5021:Map4 UTSW 9 109,867,157 (GRCm39) nonsense probably null
R5049:Map4 UTSW 9 109,908,882 (GRCm39) nonsense probably null
R5451:Map4 UTSW 9 109,866,851 (GRCm39) intron probably benign
R5452:Map4 UTSW 9 109,866,851 (GRCm39) intron probably benign
R5453:Map4 UTSW 9 109,866,851 (GRCm39) intron probably benign
R5492:Map4 UTSW 9 109,881,450 (GRCm39) missense possibly damaging 0.68
R5532:Map4 UTSW 9 109,863,746 (GRCm39) missense probably benign 0.24
R5602:Map4 UTSW 9 109,881,768 (GRCm39) missense possibly damaging 0.84
R5628:Map4 UTSW 9 109,910,915 (GRCm39) missense probably benign 0.04
R5896:Map4 UTSW 9 109,901,702 (GRCm39) missense possibly damaging 0.91
R6017:Map4 UTSW 9 109,863,687 (GRCm39) missense probably benign 0.00
R6084:Map4 UTSW 9 109,893,360 (GRCm39) missense probably damaging 1.00
R6294:Map4 UTSW 9 109,831,814 (GRCm39) missense possibly damaging 0.82
R6397:Map4 UTSW 9 109,856,784 (GRCm39) missense possibly damaging 0.78
R6773:Map4 UTSW 9 109,863,993 (GRCm39) missense probably benign 0.00
R6997:Map4 UTSW 9 109,881,982 (GRCm39) missense probably benign 0.35
R7141:Map4 UTSW 9 109,807,938 (GRCm39) start codon destroyed probably null 1.00
R7187:Map4 UTSW 9 109,882,201 (GRCm39) missense probably benign 0.03
R7320:Map4 UTSW 9 109,910,585 (GRCm39) missense probably benign 0.24
R7469:Map4 UTSW 9 109,856,865 (GRCm39) splice site probably null
R7479:Map4 UTSW 9 109,897,892 (GRCm39) missense possibly damaging 0.94
R7487:Map4 UTSW 9 109,856,783 (GRCm39) missense probably damaging 1.00
R7690:Map4 UTSW 9 109,828,861 (GRCm39) missense probably damaging 0.99
R7780:Map4 UTSW 9 109,863,720 (GRCm39) missense probably benign 0.00
R7998:Map4 UTSW 9 109,908,929 (GRCm39) missense probably damaging 1.00
R8028:Map4 UTSW 9 109,897,812 (GRCm39) missense probably damaging 1.00
R8557:Map4 UTSW 9 109,893,370 (GRCm39) splice site probably null
R8950:Map4 UTSW 9 109,901,702 (GRCm39) missense possibly damaging 0.91
R8972:Map4 UTSW 9 109,864,185 (GRCm39) missense probably benign
R9145:Map4 UTSW 9 109,855,268 (GRCm39) missense probably damaging 0.99
R9297:Map4 UTSW 9 109,882,480 (GRCm39) missense probably benign 0.02
R9332:Map4 UTSW 9 109,864,223 (GRCm39) missense probably benign 0.00
R9354:Map4 UTSW 9 109,897,847 (GRCm39) missense probably benign
R9419:Map4 UTSW 9 109,882,029 (GRCm39) missense possibly damaging 0.92
R9430:Map4 UTSW 9 109,863,760 (GRCm39) missense probably benign 0.41
R9437:Map4 UTSW 9 109,864,155 (GRCm39) missense possibly damaging 0.46
R9718:Map4 UTSW 9 109,901,774 (GRCm39) critical splice donor site probably null
Z1177:Map4 UTSW 9 109,897,591 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGACATGACTCCATCTCTGG -3'
(R):5'- TGCTAACTGGGAGTCTTCACG -3'

Sequencing Primer
(F):5'- TGGAAACAGAAATGACCCTAGGC -3'
(R):5'- TGTCTTTAATTGGAACTGTTGCTAC -3'
Posted On 2015-04-02