Incidental Mutation 'R3498:Azi2'
ID 273666
Institutional Source Beutler Lab
Gene Symbol Azi2
Ensembl Gene ENSMUSG00000039285
Gene Name 5-azacytidine induced gene 2
Synonyms AZ2
MMRRC Submission 040661-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R3498 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 117869567-117898862 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 117878475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 105 (D105G)
Ref Sequence ENSEMBL: ENSMUSP00000114980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044454] [ENSMUST00000133580] [ENSMUST00000134433] [ENSMUST00000135251] [ENSMUST00000154583]
AlphaFold Q9QYP6
Predicted Effect probably damaging
Transcript: ENSMUST00000044454
AA Change: D105G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044350
Gene: ENSMUSG00000039285
AA Change: D105G

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 224 278 4.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127189
Predicted Effect
SMART Domains Protein: ENSMUSP00000114634
Gene: ENSMUSG00000039285
AA Change: D31G

DomainStartEndE-ValueType
coiled coil region 22 123 N/A INTRINSIC
Pfam:TBD 153 197 3.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133580
AA Change: D105G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118765
Gene: ENSMUSG00000039285
AA Change: D105G

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 226 278 1.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134433
AA Change: D105G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114980
Gene: ENSMUSG00000039285
AA Change: D105G

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 224 273 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135251
SMART Domains Protein: ENSMUSP00000116971
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 20 50 N/A INTRINSIC
Pfam:TBD 77 131 1.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143024
Predicted Effect probably damaging
Transcript: ENSMUST00000154583
AA Change: D105G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122063
Gene: ENSMUSG00000039285
AA Change: D105G

DomainStartEndE-ValueType
coiled coil region 40 83 N/A INTRINSIC
Meta Mutation Damage Score 0.5414 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AZI2, or NAP1, contributes to the activation of NFKB (see MIM 164011)-dependent gene expression by activating IKK-related kinases, such as NAK (TBK1; MIM 604834) (Fujita et al., 2003 [PubMed 14560022]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired GM-CSF-derived bone marrow-derived dendritic cell differenatiation, cytokine response and ability to stimulate T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,649,350 (GRCm39) F6L probably benign Het
Aurkc A G 7: 7,003,029 (GRCm39) I175V probably damaging Het
Bcat1 A G 6: 144,965,068 (GRCm39) V45A probably damaging Het
Cass4 C T 2: 172,274,478 (GRCm39) P753L probably damaging Het
Cimip3 AC A 17: 47,744,348 (GRCm39) probably benign Het
Ddx42 A G 11: 106,122,019 (GRCm39) E178G possibly damaging Het
Dmpk T C 7: 18,820,306 (GRCm39) I101T probably damaging Het
Dnah17 C T 11: 117,971,675 (GRCm39) probably benign Het
Fosb C T 7: 19,040,557 (GRCm39) R161H probably damaging Het
Gm6729 T C 10: 86,376,582 (GRCm39) noncoding transcript Het
Gnb1 T A 4: 155,639,483 (GRCm39) N237K possibly damaging Het
Gpr35 A G 1: 92,911,113 (GRCm39) Y275C probably damaging Het
Hmcn1 A T 1: 150,480,853 (GRCm39) I4441N probably damaging Het
Ighe G A 12: 113,234,994 (GRCm39) Q389* probably null Het
Kcnj11 T C 7: 45,749,026 (GRCm39) D23G probably damaging Het
Lats2 G T 14: 57,959,923 (GRCm39) A191E possibly damaging Het
Lyplal1 A G 1: 185,820,857 (GRCm39) S197P possibly damaging Het
Map4 G T 9: 109,864,280 (GRCm39) V502L probably benign Het
Mgat5 A G 1: 127,312,571 (GRCm39) M237V possibly damaging Het
Mindy4 A G 6: 55,193,510 (GRCm39) R68G probably benign Het
Nell1 T A 7: 49,907,927 (GRCm39) V362E possibly damaging Het
Or5m8 T A 2: 85,822,774 (GRCm39) F204L probably benign Het
Or6c66b T A 10: 129,376,778 (GRCm39) I124N probably damaging Het
P4ha2 T C 11: 54,010,079 (GRCm39) Y279H probably benign Het
Pcid2 A G 8: 13,150,413 (GRCm39) V13A possibly damaging Het
Polr2j T C 5: 136,151,624 (GRCm39) I116T probably benign Het
Prdm9 A G 17: 15,783,207 (GRCm39) probably benign Het
Prr5 T A 15: 84,587,345 (GRCm39) V365E probably benign Het
Ptprf A T 4: 118,082,127 (GRCm39) I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,169,203 (GRCm39) probably benign Het
Sde2 T A 1: 180,685,750 (GRCm39) C101S probably damaging Het
Sec1 T C 7: 45,328,663 (GRCm39) H128R probably damaging Het
Serpinb6a A T 13: 34,102,764 (GRCm39) M253K probably damaging Het
Slc1a4 A T 11: 20,263,973 (GRCm39) I248N probably damaging Het
Slc22a4 T G 11: 53,882,879 (GRCm39) K328N probably benign Het
Slc24a4 A T 12: 102,200,951 (GRCm39) K278N probably benign Het
Slc6a21 T A 7: 44,930,266 (GRCm39) W222R probably damaging Het
Slc7a2 A G 8: 41,365,567 (GRCm39) E466G probably benign Het
Sspo A G 6: 48,444,914 (GRCm39) T2133A possibly damaging Het
Taco1 A G 11: 105,963,364 (GRCm39) M172V probably benign Het
Tmem127 T A 2: 127,098,040 (GRCm39) H36Q probably benign Het
Tmem229b-ps C T 10: 53,351,223 (GRCm39) noncoding transcript Het
Vac14 A G 8: 111,397,722 (GRCm39) D479G probably benign Het
Vmn1r176 T A 7: 23,534,667 (GRCm39) K162I probably benign Het
Other mutations in Azi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03085:Azi2 APN 9 117,888,214 (GRCm39) missense probably damaging 0.97
awry UTSW 9 117,876,487 (GRCm39) start codon destroyed probably null 0.99
R0166:Azi2 UTSW 9 117,884,909 (GRCm39) missense possibly damaging 0.82
R0636:Azi2 UTSW 9 117,891,125 (GRCm39) missense probably benign 0.03
R2024:Azi2 UTSW 9 117,878,390 (GRCm39) nonsense probably null
R3713:Azi2 UTSW 9 117,876,508 (GRCm39) missense possibly damaging 0.65
R3899:Azi2 UTSW 9 117,876,571 (GRCm39) missense probably damaging 1.00
R4765:Azi2 UTSW 9 117,890,539 (GRCm39) unclassified probably benign
R5227:Azi2 UTSW 9 117,876,526 (GRCm39) missense probably damaging 1.00
R5839:Azi2 UTSW 9 117,888,187 (GRCm39) missense probably damaging 1.00
R5885:Azi2 UTSW 9 117,876,628 (GRCm39) missense probably damaging 1.00
R6021:Azi2 UTSW 9 117,876,487 (GRCm39) start codon destroyed probably null 0.99
R6276:Azi2 UTSW 9 117,878,406 (GRCm39) missense probably damaging 0.96
R6408:Azi2 UTSW 9 117,890,550 (GRCm39) nonsense probably null
R6525:Azi2 UTSW 9 117,876,663 (GRCm39) missense probably damaging 0.96
R6889:Azi2 UTSW 9 117,878,963 (GRCm39) critical splice acceptor site probably null
R7391:Azi2 UTSW 9 117,879,960 (GRCm39) splice site probably null
R7693:Azi2 UTSW 9 117,876,661 (GRCm39) missense probably damaging 1.00
R7889:Azi2 UTSW 9 117,890,983 (GRCm39) missense probably benign 0.20
R8042:Azi2 UTSW 9 117,891,165 (GRCm39) missense probably benign 0.01
R8142:Azi2 UTSW 9 117,878,475 (GRCm39) missense probably damaging 0.99
R8784:Azi2 UTSW 9 117,884,960 (GRCm39) missense probably benign
R8929:Azi2 UTSW 9 117,879,044 (GRCm39) missense probably damaging 1.00
R9800:Azi2 UTSW 9 117,884,924 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CGAGCCTTCTGAAGATAGACTTAC -3'
(R):5'- GATGGCTTTAAGTCCTTAACATGC -3'

Sequencing Primer
(F):5'- AGACTTACTTGGTCTACACAGTACC -3'
(R):5'- GGCTTTAAGTCCTTAACATGCTAAAG -3'
Posted On 2015-04-02