Incidental Mutation 'R3498:Tmem229b-ps'
ID273667
Institutional Source Beutler Lab
Gene Symbol Tmem229b-ps
Ensembl Gene ENSMUSG00000056219
Gene Nametransmembrane protein 229B, pseudogene
SynonymsGm5423
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location53474964-53475469 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) C to T at 53475127 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168554
SMART Domains Protein: ENSMUSP00000132002
Gene: ENSMUSG00000056219

DomainStartEndE-ValueType
Pfam:ABC_trans_CmpB 12 148 8.5e-14 PFAM
Meta Mutation Damage Score 0.0960 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Tmem229b-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02309:Tmem229b-ps APN 10 53475370 exon noncoding transcript
IGL02503:Tmem229b-ps APN 10 53475154 exon noncoding transcript
IGL02600:Tmem229b-ps APN 10 53474956 unclassified noncoding transcript
R1515:Tmem229b-ps UTSW 10 53475446 exon noncoding transcript
R1595:Tmem229b-ps UTSW 10 53475289 exon noncoding transcript
R2010:Tmem229b-ps UTSW 10 53475199 exon noncoding transcript
R2116:Tmem229b-ps UTSW 10 53475456 exon noncoding transcript
R3499:Tmem229b-ps UTSW 10 53475127 exon noncoding transcript
R4281:Tmem229b-ps UTSW 10 53475378 exon noncoding transcript
R5405:Tmem229b-ps UTSW 10 53475229 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATGTCTGTTCTCAGCCACGC -3'
(R):5'- TGAGGCCCATGAAATCAAAGTCG -3'

Sequencing Primer
(F):5'- GATAACAGTAGGCCCCAGTTGTTAC -3'
(R):5'- TCAAAGTCGAACTGGGAGTAGTCC -3'
Posted On2015-04-02