Incidental Mutation 'R3498:Tmem229b-ps'
ID 273667
Institutional Source Beutler Lab
Gene Symbol Tmem229b-ps
Ensembl Gene ENSMUSG00000056219
Gene Name transmembrane protein 229B, pseudogene
Synonyms Gm5423
MMRRC Submission 040661-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.209) question?
Stock # R3498 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 53351060-53351565 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) C to T at 53351223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168554
SMART Domains Protein: ENSMUSP00000132002
Gene: ENSMUSG00000056219

DomainStartEndE-ValueType
Pfam:ABC_trans_CmpB 12 148 8.5e-14 PFAM
Meta Mutation Damage Score 0.0960 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,649,350 (GRCm39) F6L probably benign Het
Aurkc A G 7: 7,003,029 (GRCm39) I175V probably damaging Het
Azi2 A G 9: 117,878,475 (GRCm39) D105G probably damaging Het
Bcat1 A G 6: 144,965,068 (GRCm39) V45A probably damaging Het
Cass4 C T 2: 172,274,478 (GRCm39) P753L probably damaging Het
Cimip3 AC A 17: 47,744,348 (GRCm39) probably benign Het
Ddx42 A G 11: 106,122,019 (GRCm39) E178G possibly damaging Het
Dmpk T C 7: 18,820,306 (GRCm39) I101T probably damaging Het
Dnah17 C T 11: 117,971,675 (GRCm39) probably benign Het
Fosb C T 7: 19,040,557 (GRCm39) R161H probably damaging Het
Gm6729 T C 10: 86,376,582 (GRCm39) noncoding transcript Het
Gnb1 T A 4: 155,639,483 (GRCm39) N237K possibly damaging Het
Gpr35 A G 1: 92,911,113 (GRCm39) Y275C probably damaging Het
Hmcn1 A T 1: 150,480,853 (GRCm39) I4441N probably damaging Het
Ighe G A 12: 113,234,994 (GRCm39) Q389* probably null Het
Kcnj11 T C 7: 45,749,026 (GRCm39) D23G probably damaging Het
Lats2 G T 14: 57,959,923 (GRCm39) A191E possibly damaging Het
Lyplal1 A G 1: 185,820,857 (GRCm39) S197P possibly damaging Het
Map4 G T 9: 109,864,280 (GRCm39) V502L probably benign Het
Mgat5 A G 1: 127,312,571 (GRCm39) M237V possibly damaging Het
Mindy4 A G 6: 55,193,510 (GRCm39) R68G probably benign Het
Nell1 T A 7: 49,907,927 (GRCm39) V362E possibly damaging Het
Or5m8 T A 2: 85,822,774 (GRCm39) F204L probably benign Het
Or6c66b T A 10: 129,376,778 (GRCm39) I124N probably damaging Het
P4ha2 T C 11: 54,010,079 (GRCm39) Y279H probably benign Het
Pcid2 A G 8: 13,150,413 (GRCm39) V13A possibly damaging Het
Polr2j T C 5: 136,151,624 (GRCm39) I116T probably benign Het
Prdm9 A G 17: 15,783,207 (GRCm39) probably benign Het
Prr5 T A 15: 84,587,345 (GRCm39) V365E probably benign Het
Ptprf A T 4: 118,082,127 (GRCm39) I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,169,203 (GRCm39) probably benign Het
Sde2 T A 1: 180,685,750 (GRCm39) C101S probably damaging Het
Sec1 T C 7: 45,328,663 (GRCm39) H128R probably damaging Het
Serpinb6a A T 13: 34,102,764 (GRCm39) M253K probably damaging Het
Slc1a4 A T 11: 20,263,973 (GRCm39) I248N probably damaging Het
Slc22a4 T G 11: 53,882,879 (GRCm39) K328N probably benign Het
Slc24a4 A T 12: 102,200,951 (GRCm39) K278N probably benign Het
Slc6a21 T A 7: 44,930,266 (GRCm39) W222R probably damaging Het
Slc7a2 A G 8: 41,365,567 (GRCm39) E466G probably benign Het
Sspo A G 6: 48,444,914 (GRCm39) T2133A possibly damaging Het
Taco1 A G 11: 105,963,364 (GRCm39) M172V probably benign Het
Tmem127 T A 2: 127,098,040 (GRCm39) H36Q probably benign Het
Vac14 A G 8: 111,397,722 (GRCm39) D479G probably benign Het
Vmn1r176 T A 7: 23,534,667 (GRCm39) K162I probably benign Het
Other mutations in Tmem229b-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02309:Tmem229b-ps APN 10 53,351,466 (GRCm39) exon noncoding transcript
IGL02503:Tmem229b-ps APN 10 53,351,250 (GRCm39) exon noncoding transcript
IGL02600:Tmem229b-ps APN 10 53,351,052 (GRCm39) unclassified noncoding transcript
R1515:Tmem229b-ps UTSW 10 53,351,542 (GRCm39) exon noncoding transcript
R1595:Tmem229b-ps UTSW 10 53,351,385 (GRCm39) exon noncoding transcript
R2010:Tmem229b-ps UTSW 10 53,351,295 (GRCm39) exon noncoding transcript
R2116:Tmem229b-ps UTSW 10 53,351,552 (GRCm39) exon noncoding transcript
R3499:Tmem229b-ps UTSW 10 53,351,223 (GRCm39) exon noncoding transcript
R4281:Tmem229b-ps UTSW 10 53,351,474 (GRCm39) exon noncoding transcript
R5405:Tmem229b-ps UTSW 10 53,351,325 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATGTCTGTTCTCAGCCACGC -3'
(R):5'- TGAGGCCCATGAAATCAAAGTCG -3'

Sequencing Primer
(F):5'- GATAACAGTAGGCCCCAGTTGTTAC -3'
(R):5'- TCAAAGTCGAACTGGGAGTAGTCC -3'
Posted On 2015-04-02