Incidental Mutation 'R3498:Slc24a4'
ID273677
Institutional Source Beutler Lab
Gene Symbol Slc24a4
Ensembl Gene ENSMUSG00000041771
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 4
SynonymsNCKX4, A930002M03Rik
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102128733-102267091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102234692 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 278 (K278N)
Ref Sequence ENSEMBL: ENSMUSP00000124513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079020] [ENSMUST00000159329]
Predicted Effect probably benign
Transcript: ENSMUST00000079020
AA Change: K280N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078030
Gene: ENSMUSG00000041771
AA Change: K280N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Na_Ca_ex 86 229 2.4e-31 PFAM
low complexity region 367 388 N/A INTRINSIC
Pfam:Na_Ca_ex 435 587 2.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159329
AA Change: K278N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124513
Gene: ENSMUSG00000041771
AA Change: K278N

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Na_Ca_ex 113 245 1e-32 PFAM
low complexity region 365 386 N/A INTRINSIC
Pfam:Na_Ca_ex 443 562 1.4e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161325
AA Change: K277N
SMART Domains Protein: ENSMUSP00000125012
Gene: ENSMUSG00000041771
AA Change: K277N

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Na_Ca_ex 103 246 1.3e-31 PFAM
low complexity region 365 386 N/A INTRINSIC
Pfam:Na_Ca_ex 433 585 1.3e-30 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium-dependent sodium/calcium exchanger protein family. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired olfactory response and reduced weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Slc24a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Slc24a4 APN 12 102223635 missense probably benign 0.09
IGL01724:Slc24a4 APN 12 102218960 missense possibly damaging 0.78
IGL01767:Slc24a4 APN 12 102223687 splice site probably benign
IGL01814:Slc24a4 APN 12 102254618 missense probably benign 0.00
IGL02047:Slc24a4 APN 12 102254623 missense probably damaging 1.00
IGL02449:Slc24a4 APN 12 102227082 missense probably benign 0.00
IGL02632:Slc24a4 APN 12 102234682 missense probably benign 0.15
IGL03251:Slc24a4 APN 12 102222825 missense probably damaging 0.98
spindly UTSW 12 102264944 critical splice donor site probably null
R0207:Slc24a4 UTSW 12 102228951 critical splice donor site probably null
R0284:Slc24a4 UTSW 12 102260481 missense probably damaging 1.00
R0506:Slc24a4 UTSW 12 102131623 critical splice donor site probably null
R1903:Slc24a4 UTSW 12 102131617 missense probably benign 0.00
R2004:Slc24a4 UTSW 12 102213907 missense probably damaging 1.00
R2126:Slc24a4 UTSW 12 102222759 missense probably damaging 1.00
R2518:Slc24a4 UTSW 12 102222051 missense probably benign 0.02
R3620:Slc24a4 UTSW 12 102218963 missense probably damaging 1.00
R3621:Slc24a4 UTSW 12 102218963 missense probably damaging 1.00
R4917:Slc24a4 UTSW 12 102264944 critical splice donor site probably null
R5028:Slc24a4 UTSW 12 102264370 missense probably damaging 1.00
R5886:Slc24a4 UTSW 12 102260415 missense probably damaging 1.00
R5914:Slc24a4 UTSW 12 102234790 missense probably damaging 1.00
R6257:Slc24a4 UTSW 12 102254510 missense probably benign 0.00
R6305:Slc24a4 UTSW 12 102222101 missense possibly damaging 0.84
R6313:Slc24a4 UTSW 12 102254510 missense probably benign 0.00
R6734:Slc24a4 UTSW 12 102219000 missense probably damaging 1.00
R7378:Slc24a4 UTSW 12 102239176 missense probably benign 0.06
R7419:Slc24a4 UTSW 12 102227091 critical splice donor site probably null
R7529:Slc24a4 UTSW 12 102264448 missense probably benign 0.01
R7715:Slc24a4 UTSW 12 102218960 missense possibly damaging 0.89
R7781:Slc24a4 UTSW 12 102234853 critical splice donor site probably null
R8258:Slc24a4 UTSW 12 102254669 missense probably damaging 1.00
R8259:Slc24a4 UTSW 12 102254669 missense probably damaging 1.00
Z1176:Slc24a4 UTSW 12 102228898 missense probably damaging 1.00
Z1176:Slc24a4 UTSW 12 102239238 missense probably benign 0.01
Z1177:Slc24a4 UTSW 12 102260420 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATCAGCAACAGTTTATCTGC -3'
(R):5'- CCATGTGCTGGGTTAACTTACTTC -3'

Sequencing Primer
(F):5'- TACAGAAGTAAGCCACACTTTAAGG -3'
(R):5'- CATTAATTATGATCCTGCTGGCC -3'
Posted On2015-04-02