Incidental Mutation 'R3498:Serpinb6a'
ID273679
Institutional Source Beutler Lab
Gene Symbol Serpinb6a
Ensembl Gene ENSMUSG00000060147
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6a
Synonymsovalbumin, D330015H01Rik, 4930482L21Rik, Spi3
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location33917918-34002794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33918781 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 253 (M253K)
Ref Sequence ENSEMBL: ENSMUSP00000017188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017188] [ENSMUST00000043552] [ENSMUST00000076532] [ENSMUST00000167163] [ENSMUST00000167260] [ENSMUST00000168350] [ENSMUST00000171034] [ENSMUST00000171252]
Predicted Effect probably damaging
Transcript: ENSMUST00000017188
AA Change: M253K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017188
Gene: ENSMUSG00000060147
AA Change: M253K

DomainStartEndE-ValueType
SERPIN 34 399 2.84e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043552
AA Change: M232K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041016
Gene: ENSMUSG00000060147
AA Change: M232K

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076532
AA Change: M232K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147
AA Change: M232K

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167163
AA Change: M232K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131115
Gene: ENSMUSG00000060147
AA Change: M232K

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167260
SMART Domains Protein: ENSMUSP00000127768
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 193 1.34e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168350
SMART Domains Protein: ENSMUSP00000130356
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 162 9.24e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171034
SMART Domains Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 228 3.54e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171252
SMART Domains Protein: ENSMUSP00000126162
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 188 4.71e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171985
Meta Mutation Damage Score 0.9736 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and developmentally normal, with no apparent alterations in growth, leukocyte function, or sensitivity to cerebral ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Serpinb6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Serpinb6a APN 13 33931512 missense possibly damaging 0.54
IGL01356:Serpinb6a APN 13 33925417 missense possibly damaging 0.76
IGL01458:Serpinb6a APN 13 33930081 missense possibly damaging 0.56
IGL01539:Serpinb6a APN 13 33930134 missense probably damaging 1.00
IGL02795:Serpinb6a APN 13 33931593 missense probably damaging 1.00
IGL02885:Serpinb6a APN 13 33918799 missense probably benign 0.11
IGL02971:Serpinb6a APN 13 33931470 critical splice donor site probably null
R0829:Serpinb6a UTSW 13 33935701 utr 5 prime probably benign
R1324:Serpinb6a UTSW 13 33918360 missense probably damaging 1.00
R2232:Serpinb6a UTSW 13 33925320 missense probably damaging 0.97
R4982:Serpinb6a UTSW 13 33918874 missense probably damaging 0.99
R5131:Serpinb6a UTSW 13 33918872 missense probably benign 0.42
R5132:Serpinb6a UTSW 13 33918322 missense probably benign 0.00
R6149:Serpinb6a UTSW 13 33918360 missense probably damaging 1.00
R6427:Serpinb6a UTSW 13 33918259 missense probably damaging 0.99
R6937:Serpinb6a UTSW 13 33918818 missense possibly damaging 0.81
R7806:Serpinb6a UTSW 13 33935565 splice site probably null
R7830:Serpinb6a UTSW 13 33930047 missense probably benign 0.09
R7948:Serpinb6a UTSW 13 33923020 missense probably benign 0.00
R7949:Serpinb6a UTSW 13 33923020 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGTAACCTATTATGATAGCTGGG -3'
(R):5'- TGCCCAATGTGTCACATGTG -3'

Sequencing Primer
(F):5'- AGTGTTTACTACGCATGCTCTAG -3'
(R):5'- CAATGTGTCACATGTGTCACC -3'
Posted On2015-04-02