Mutagenetix > Incidental Mutation

Incidental Mutation 'R3498:Serpinb6a'

273679

Institutional Source

Beutler Lab

Gene Symbol

Serpinb6a

Ensembl Gene

ENSMUSG00000060147

Gene Name

serine (or cysteine) peptidase inhibitor, clade B, member 6a

Synonyms

ovalbumin, D330015H01Rik, 4930482L21Rik, Spi3

MMRRC Submission

040661-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3498 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33917918-34002794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 33918781 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 253 (M253K)

Ref Sequence

ENSEMBL: ENSMUSP00000017188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017188] [ENSMUST00000043552] [ENSMUST00000076532] [ENSMUST00000167163] [ENSMUST00000167260] [ENSMUST00000168350] [ENSMUST00000171034] [ENSMUST00000171252]

AlphaFold

Q60854

Predicted Effect

probably damaging
Transcript: ENSMUST00000017188
AA Change: M253K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000017188
Gene: ENSMUSG00000060147
AA Change: M253K

Domain	Start	End	E-Value	Type
SERPIN	34	399	2.84e-179	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000043552
AA Change: M232K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000041016
Gene: ENSMUSG00000060147
AA Change: M232K

Domain	Start	End	E-Value	Type
SERPIN	13	378	2.84e-179	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000076532
AA Change: M232K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147
AA Change: M232K

Domain	Start	End	E-Value	Type
SERPIN	13	378	2.84e-179	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167163
AA Change: M232K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131115
Gene: ENSMUSG00000060147
AA Change: M232K

Domain	Start	End	E-Value	Type
SERPIN	13	378	2.84e-179	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167260

SMART Domains

Protein: ENSMUSP00000127768
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
SERPIN	13	193	1.34e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168350

SMART Domains

Protein: ENSMUSP00000130356
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
SERPIN	13	162	9.24e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171034

SMART Domains

Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
SERPIN	13	228	3.54e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171252

SMART Domains

Protein: ENSMUSP00000126162
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
SERPIN	13	188	4.71e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171985

Meta Mutation Damage Score

0.9736

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and developmentally normal, with no apparent alterations in growth, leukocyte function, or sensitivity to cerebral ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
A3galt2	T	C	4: 128,755,557	F6L	probably benign	Het
Aurkc	A	G	7: 7,000,030	I175V	probably damaging	Het
Azi2	A	G	9: 118,049,407	D105G	probably damaging	Het
Bcat1	A	G	6: 145,019,342	V45A	probably damaging	Het
Cass4	C	T	2: 172,432,558	P753L	probably damaging	Het
Ddx42	A	G	11: 106,231,193	E178G	possibly damaging	Het
Dmpk	T	C	7: 19,086,381	I101T	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Fosb	C	T	7: 19,306,632	R161H	probably damaging	Het
Gm6729	T	C	10: 86,540,718		noncoding transcript	Het
Gnb1	T	A	4: 155,555,026	N237K	possibly damaging	Het
Gpr35	A	G	1: 92,983,391	Y275C	probably damaging	Het
Hmcn1	A	T	1: 150,605,102	I4441N	probably damaging	Het
Ighe	G	A	12: 113,271,374	Q389*	probably null	Het
Kcnj11	T	C	7: 46,099,602	D23G	probably damaging	Het
Lats2	G	T	14: 57,722,466	A191E	possibly damaging	Het
Lyplal1	A	G	1: 186,088,660	S197P	possibly damaging	Het
Map4	G	T	9: 110,035,212	V502L	probably benign	Het
Mgat5	A	G	1: 127,384,834	M237V	possibly damaging	Het
Mindy4	A	G	6: 55,216,525	R68G	probably benign	Het
Nell1	T	A	7: 50,258,179	V362E	possibly damaging	Het
Olfr1031	T	A	2: 85,992,430	F204L	probably benign	Het
Olfr792	T	A	10: 129,540,909	I124N	probably damaging	Het
P4ha2	T	C	11: 54,119,253	Y279H	probably benign	Het
Pcid2	A	G	8: 13,100,413	V13A	possibly damaging	Het
Polr2j	T	C	5: 136,122,770	I116T	probably benign	Het
Prdm9	A	G	17: 15,562,945		probably benign	Het
Prr5	T	A	15: 84,703,144	V365E	probably benign	Het
Ptprf	A	T	4: 118,224,930	I1037N	probably damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Sde2	T	A	1: 180,858,185	C101S	probably damaging	Het
Sec1	T	C	7: 45,679,239	H128R	probably damaging	Het
Slc1a4	A	T	11: 20,313,973	I248N	probably damaging	Het
Slc22a4	T	G	11: 53,992,053	K328N	probably benign	Het
Slc24a4	A	T	12: 102,234,692	K278N	probably benign	Het
Slc6a21	T	A	7: 45,280,842	W222R	probably damaging	Het
Slc7a2	A	G	8: 40,912,530	E466G	probably benign	Het
Sspo	A	G	6: 48,467,980	T2133A	possibly damaging	Het
Taco1	A	G	11: 106,072,538	M172V	probably benign	Het
Tmem127	T	A	2: 127,256,120	H36Q	probably benign	Het
Tmem229b-ps	C	T	10: 53,475,127		noncoding transcript	Het
Vac14	A	G	8: 110,671,090	D479G	probably benign	Het
Vmn1r176	T	A	7: 23,835,242	K162I	probably benign	Het

Other mutations in Serpinb6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Serpinb6a	APN	13	33931512	missense	possibly damaging	0.54
IGL01356:Serpinb6a	APN	13	33925417	missense	possibly damaging	0.76
IGL01458:Serpinb6a	APN	13	33930081	missense	possibly damaging	0.56
IGL01539:Serpinb6a	APN	13	33930134	missense	probably damaging	1.00
IGL02795:Serpinb6a	APN	13	33931593	missense	probably damaging	1.00
IGL02885:Serpinb6a	APN	13	33918799	missense	probably benign	0.11
IGL02971:Serpinb6a	APN	13	33931470	critical splice donor site	probably null
R0829:Serpinb6a	UTSW	13	33935701	utr 5 prime	probably benign
R1324:Serpinb6a	UTSW	13	33918360	missense	probably damaging	1.00
R2232:Serpinb6a	UTSW	13	33925320	missense	probably damaging	0.97
R4982:Serpinb6a	UTSW	13	33918874	missense	probably damaging	0.99
R5131:Serpinb6a	UTSW	13	33918872	missense	probably benign	0.42
R5132:Serpinb6a	UTSW	13	33918322	missense	probably benign	0.00
R6149:Serpinb6a	UTSW	13	33918360	missense	probably damaging	1.00
R6427:Serpinb6a	UTSW	13	33918259	missense	probably damaging	0.99
R6937:Serpinb6a	UTSW	13	33918818	missense	possibly damaging	0.81
R7806:Serpinb6a	UTSW	13	33935565	splice site	probably null
R7830:Serpinb6a	UTSW	13	33930047	missense	probably benign	0.09
R7948:Serpinb6a	UTSW	13	33923020	missense	probably benign	0.00
R7949:Serpinb6a	UTSW	13	33923020	missense	probably benign	0.00
R8531:Serpinb6a	UTSW	13	33931479	missense	probably damaging	0.99
R8773:Serpinb6a	UTSW	13	33931560	missense	probably damaging	1.00
R9117:Serpinb6a	UTSW	13	33925429	missense	probably benign	0.35
R9182:Serpinb6a	UTSW	13	33925377	missense	probably damaging	1.00
R9565:Serpinb6a	UTSW	13	33918417	missense	probably damaging	1.00
R9781:Serpinb6a	UTSW	13	33925363	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCTGTAACCTATTATGATAGCTGGG -3'
(R):5'- TGCCCAATGTGTCACATGTG -3'

Sequencing Primer
(F):5'- AGTGTTTACTACGCATGCTCTAG -3'
(R):5'- CAATGTGTCACATGTGTCACC -3'

Posted On

2015-04-02