Incidental Mutation 'R3498:Prdm9'
ID 273681
Institutional Source Beutler Lab
Gene Symbol Prdm9
Ensembl Gene ENSMUSG00000051977
Gene Name PR domain containing 9
Synonyms Meisetz, repro7, Dsbc1, Rcr1, G1-419-29
MMRRC Submission 040661-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.351) question?
Stock # R3498 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 15763341-15784616 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 15783207 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147532] [ENSMUST00000167994]
AlphaFold Q96EQ9
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139911
Predicted Effect probably benign
Transcript: ENSMUST00000147532
SMART Domains Protein: ENSMUSP00000118454
Gene: ENSMUSG00000051977

DomainStartEndE-ValueType
Pfam:SSXRD 49 81 1.8e-19 PFAM
SET 123 243 2.56e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167994
SMART Domains Protein: ENSMUSP00000131871
Gene: ENSMUSG00000051977

DomainStartEndE-ValueType
KRAB 30 89 5.54e-8 SMART
Pfam:SSXRD 175 205 1.5e-20 PFAM
SET 248 368 2.56e-2 SMART
ZnF_C2H2 392 415 3.29e-1 SMART
ZnF_C2H2 516 535 4.74e1 SMART
ZnF_C2H2 541 563 9.73e-4 SMART
ZnF_C2H2 569 591 1.3e-4 SMART
ZnF_C2H2 597 619 1.3e-4 SMART
ZnF_C2H2 625 647 4.24e-4 SMART
ZnF_C2H2 653 675 4.24e-4 SMART
ZnF_C2H2 681 703 1.95e-3 SMART
ZnF_C2H2 709 731 5.99e-4 SMART
ZnF_C2H2 737 759 1.95e-3 SMART
ZnF_C2H2 765 787 1.95e-3 SMART
ZnF_C2H2 793 815 1.3e-4 SMART
ZnF_C2H2 821 843 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178455
SMART Domains Protein: ENSMUSP00000137164
Gene: ENSMUSG00000095920

DomainStartEndE-ValueType
Pfam:Ribosomal_S21 11 50 1.4e-13 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein with histone methyltransferase activity that catalyzes histone H3 lysine 4 trimethylation (H3K4me3) during meiotic prophase. This protein contains multiple domains, including a Kruppel-associated box (KRAB) domain, an SSX repression domain (SSXRD), a PRD1-BF1 and RIZ homologous region, a subclass of SET (PR/SET) domain, and a tandem array of C2H2 zinc fingers. The zinc finger array recognizes a short sequence motif, leading to local H3K4me3, and meiotic recombination hotspot activity. The observed allelic variation alters the DNA-binding sequence specificity of the protein, resulting in distinct meiotic recombination hotspots amongst individuals and populations. Multiple alternate alleles of this gene have been described. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased oocyte number, azoospermia, and sterility in both sexes due to severe impairment of the double-stranded break repair pathway, deficient pairing of homologous chromosomes, and impaired sex body formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,649,350 (GRCm39) F6L probably benign Het
Aurkc A G 7: 7,003,029 (GRCm39) I175V probably damaging Het
Azi2 A G 9: 117,878,475 (GRCm39) D105G probably damaging Het
Bcat1 A G 6: 144,965,068 (GRCm39) V45A probably damaging Het
Cass4 C T 2: 172,274,478 (GRCm39) P753L probably damaging Het
Cimip3 AC A 17: 47,744,348 (GRCm39) probably benign Het
Ddx42 A G 11: 106,122,019 (GRCm39) E178G possibly damaging Het
Dmpk T C 7: 18,820,306 (GRCm39) I101T probably damaging Het
Dnah17 C T 11: 117,971,675 (GRCm39) probably benign Het
Fosb C T 7: 19,040,557 (GRCm39) R161H probably damaging Het
Gm6729 T C 10: 86,376,582 (GRCm39) noncoding transcript Het
Gnb1 T A 4: 155,639,483 (GRCm39) N237K possibly damaging Het
Gpr35 A G 1: 92,911,113 (GRCm39) Y275C probably damaging Het
Hmcn1 A T 1: 150,480,853 (GRCm39) I4441N probably damaging Het
Ighe G A 12: 113,234,994 (GRCm39) Q389* probably null Het
Kcnj11 T C 7: 45,749,026 (GRCm39) D23G probably damaging Het
Lats2 G T 14: 57,959,923 (GRCm39) A191E possibly damaging Het
Lyplal1 A G 1: 185,820,857 (GRCm39) S197P possibly damaging Het
Map4 G T 9: 109,864,280 (GRCm39) V502L probably benign Het
Mgat5 A G 1: 127,312,571 (GRCm39) M237V possibly damaging Het
Mindy4 A G 6: 55,193,510 (GRCm39) R68G probably benign Het
Nell1 T A 7: 49,907,927 (GRCm39) V362E possibly damaging Het
Or5m8 T A 2: 85,822,774 (GRCm39) F204L probably benign Het
Or6c66b T A 10: 129,376,778 (GRCm39) I124N probably damaging Het
P4ha2 T C 11: 54,010,079 (GRCm39) Y279H probably benign Het
Pcid2 A G 8: 13,150,413 (GRCm39) V13A possibly damaging Het
Polr2j T C 5: 136,151,624 (GRCm39) I116T probably benign Het
Prr5 T A 15: 84,587,345 (GRCm39) V365E probably benign Het
Ptprf A T 4: 118,082,127 (GRCm39) I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,169,203 (GRCm39) probably benign Het
Sde2 T A 1: 180,685,750 (GRCm39) C101S probably damaging Het
Sec1 T C 7: 45,328,663 (GRCm39) H128R probably damaging Het
Serpinb6a A T 13: 34,102,764 (GRCm39) M253K probably damaging Het
Slc1a4 A T 11: 20,263,973 (GRCm39) I248N probably damaging Het
Slc22a4 T G 11: 53,882,879 (GRCm39) K328N probably benign Het
Slc24a4 A T 12: 102,200,951 (GRCm39) K278N probably benign Het
Slc6a21 T A 7: 44,930,266 (GRCm39) W222R probably damaging Het
Slc7a2 A G 8: 41,365,567 (GRCm39) E466G probably benign Het
Sspo A G 6: 48,444,914 (GRCm39) T2133A possibly damaging Het
Taco1 A G 11: 105,963,364 (GRCm39) M172V probably benign Het
Tmem127 T A 2: 127,098,040 (GRCm39) H36Q probably benign Het
Tmem229b-ps C T 10: 53,351,223 (GRCm39) noncoding transcript Het
Vac14 A G 8: 111,397,722 (GRCm39) D479G probably benign Het
Vmn1r176 T A 7: 23,534,667 (GRCm39) K162I probably benign Het
Other mutations in Prdm9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Prdm9 APN 17 15,773,608 (GRCm39) missense probably benign 0.11
IGL02322:Prdm9 APN 17 15,783,110 (GRCm39) missense probably damaging 0.99
IGL02354:Prdm9 APN 17 15,783,109 (GRCm39) missense probably damaging 1.00
IGL02361:Prdm9 APN 17 15,783,109 (GRCm39) missense probably damaging 1.00
IGL02724:Prdm9 APN 17 15,783,522 (GRCm39) missense probably benign 0.07
IGL03120:Prdm9 APN 17 15,765,193 (GRCm39) missense probably benign
berlin UTSW 17 15,782,702 (GRCm39) missense probably damaging 0.96
R0173:Prdm9 UTSW 17 15,764,297 (GRCm39) missense probably benign 0.00
R0173:Prdm9 UTSW 17 15,764,275 (GRCm39) missense probably benign 0.02
R0309:Prdm9 UTSW 17 15,777,646 (GRCm39) missense probably damaging 0.98
R1420:Prdm9 UTSW 17 15,764,638 (GRCm39) missense probably damaging 1.00
R3714:Prdm9 UTSW 17 15,777,623 (GRCm39) nonsense probably null
R4118:Prdm9 UTSW 17 15,764,275 (GRCm39) missense probably benign 0.02
R4369:Prdm9 UTSW 17 15,764,708 (GRCm39) missense probably benign 0.14
R4691:Prdm9 UTSW 17 15,773,640 (GRCm39) missense probably benign 0.03
R4742:Prdm9 UTSW 17 15,773,783 (GRCm39) missense probably damaging 0.99
R4910:Prdm9 UTSW 17 15,764,585 (GRCm39) missense probably benign 0.08
R5056:Prdm9 UTSW 17 15,782,679 (GRCm39) missense possibly damaging 0.93
R5130:Prdm9 UTSW 17 15,764,729 (GRCm39) missense probably benign 0.00
R5175:Prdm9 UTSW 17 15,777,713 (GRCm39) missense probably benign 0.04
R5187:Prdm9 UTSW 17 15,783,155 (GRCm39) missense probably damaging 0.98
R5213:Prdm9 UTSW 17 15,775,416 (GRCm39) missense probably damaging 0.98
R5270:Prdm9 UTSW 17 15,773,625 (GRCm39) missense probably benign 0.16
R5635:Prdm9 UTSW 17 15,782,702 (GRCm39) missense probably damaging 0.96
R6753:Prdm9 UTSW 17 15,765,218 (GRCm39) missense probably benign 0.00
R6857:Prdm9 UTSW 17 15,764,518 (GRCm39) missense probably benign 0.04
R7041:Prdm9 UTSW 17 15,765,257 (GRCm39) missense possibly damaging 0.56
R7355:Prdm9 UTSW 17 15,765,497 (GRCm39) missense probably benign 0.01
R7410:Prdm9 UTSW 17 15,765,259 (GRCm39) missense possibly damaging 0.73
R7570:Prdm9 UTSW 17 15,775,914 (GRCm39) missense probably benign 0.14
R7571:Prdm9 UTSW 17 15,783,526 (GRCm39) missense probably damaging 0.98
R7575:Prdm9 UTSW 17 15,764,890 (GRCm39) missense probably damaging 1.00
R7593:Prdm9 UTSW 17 15,764,867 (GRCm39) missense possibly damaging 0.81
R7664:Prdm9 UTSW 17 15,775,833 (GRCm39) missense probably damaging 0.99
R7755:Prdm9 UTSW 17 15,765,226 (GRCm39) missense probably damaging 1.00
R7817:Prdm9 UTSW 17 15,779,311 (GRCm39) missense probably damaging 1.00
R7875:Prdm9 UTSW 17 15,773,804 (GRCm39) nonsense probably null
R8110:Prdm9 UTSW 17 15,774,960 (GRCm39) missense probably damaging 1.00
R8222:Prdm9 UTSW 17 15,765,035 (GRCm39) missense possibly damaging 0.93
R8405:Prdm9 UTSW 17 15,764,456 (GRCm39) missense probably benign 0.22
R8695:Prdm9 UTSW 17 15,765,019 (GRCm39) missense probably damaging 1.00
R8947:Prdm9 UTSW 17 15,764,270 (GRCm39) missense possibly damaging 0.96
X0021:Prdm9 UTSW 17 15,773,734 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTGTAGATACCTGGGAAGAC -3'
(R):5'- AAGGTGGGTCCCGATATGTG -3'

Sequencing Primer
(F):5'- GGAAGACCCTAACATAACATGGG -3'
(R):5'- TGGGTCCCGATATGTGAGAGAG -3'
Posted On 2015-04-02