Incidental Mutation 'R3498:1700001C19Rik'
ID273682
Institutional Source Beutler Lab
Gene Symbol 1700001C19Rik
Ensembl Gene ENSMUSG00000047150
Gene NameRIKEN cDNA 1700001C19 gene
Synonyms
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3498 (G1)
Quality Score217
Status Validated
Chromosome17
Chromosomal Location47412734-47437376 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) AC to A at 47433423 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037701] [ENSMUST00000061885] [ENSMUST00000150819]
Predicted Effect probably benign
Transcript: ENSMUST00000037701
SMART Domains Protein: ENSMUSP00000045345
Gene: ENSMUSG00000034382

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061885
SMART Domains Protein: ENSMUSP00000050873
Gene: ENSMUSG00000047150

DomainStartEndE-ValueType
low complexity region 74 86 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150819
SMART Domains Protein: ENSMUSP00000120133
Gene: ENSMUSG00000034382

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 237 N/A INTRINSIC
low complexity region 294 312 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 384 423 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 612 627 N/A INTRINSIC
internal_repeat_1 628 654 6.24e-9 PROSPERO
low complexity region 656 671 N/A INTRINSIC
internal_repeat_1 688 714 6.24e-9 PROSPERO
low complexity region 853 863 N/A INTRINSIC
low complexity region 976 1016 N/A INTRINSIC
low complexity region 1147 1154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160678
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in 1700001C19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0675:1700001C19Rik UTSW 17 47413776 missense probably benign 0.25
R1529:1700001C19Rik UTSW 17 47413890 missense probably benign 0.11
R2256:1700001C19Rik UTSW 17 47433423 unclassified probably benign
R2257:1700001C19Rik UTSW 17 47433423 unclassified probably benign
R2512:1700001C19Rik UTSW 17 47413726 missense probably benign
R2883:1700001C19Rik UTSW 17 47436725 missense probably damaging 0.99
R3499:1700001C19Rik UTSW 17 47433423 unclassified probably benign
R3834:1700001C19Rik UTSW 17 47433423 unclassified probably benign
R3835:1700001C19Rik UTSW 17 47433423 unclassified probably benign
R3901:1700001C19Rik UTSW 17 47433423 unclassified probably benign
R3910:1700001C19Rik UTSW 17 47433423 unclassified probably benign
R3911:1700001C19Rik UTSW 17 47433423 unclassified probably benign
R3913:1700001C19Rik UTSW 17 47433423 unclassified probably benign
R4191:1700001C19Rik UTSW 17 47436637 missense probably damaging 0.99
R4280:1700001C19Rik UTSW 17 47413855 missense probably benign 0.02
R7054:1700001C19Rik UTSW 17 47437189 critical splice donor site probably null
R8008:1700001C19Rik UTSW 17 47436736 missense probably damaging 0.98
Z1176:1700001C19Rik UTSW 17 47413734 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CGGATTGTCTTTTAGAACAACCCTC -3'
(R):5'- CAGTTATCATGCAGTAGCCCC -3'

Sequencing Primer
(F):5'- ACTGTAGCTCCGTGTAGAACC -3'
(R):5'- GTAGCCCCCGTCCCTATTAAAATAG -3'
Posted On2015-04-02