Incidental Mutation 'R3499:Gpr35'
ID 273684
Institutional Source Beutler Lab
Gene Symbol Gpr35
Ensembl Gene ENSMUSG00000026271
Gene Name G protein-coupled receptor 35
Synonyms
MMRRC Submission 040662-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3499 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 92950865-92986391 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92983391 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 275 (Y275C)
Ref Sequence ENSEMBL: ENSMUSP00000139648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027489] [ENSMUST00000064480] [ENSMUST00000169198] [ENSMUST00000185421] [ENSMUST00000186298] [ENSMUST00000189697]
AlphaFold Q9ES90
Predicted Effect probably damaging
Transcript: ENSMUST00000027489
AA Change: Y59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027489
Gene: ENSMUSG00000026271
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 289 3.5e-7 PFAM
Pfam:7tm_1 34 275 1.8e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064480
AA Change: Y275C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070832
Gene: ENSMUSG00000026271
AA Change: Y275C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 289 3.5e-7 PFAM
Pfam:7tm_1 34 275 3.6e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169198
AA Change: Y275C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126914
Gene: ENSMUSG00000026271
AA Change: Y275C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 289 3.5e-7 PFAM
Pfam:7tm_1 34 275 3.6e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185421
Predicted Effect probably damaging
Transcript: ENSMUST00000186298
AA Change: Y275C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139648
Gene: ENSMUSG00000026271
AA Change: Y275C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 289 3.5e-7 PFAM
Pfam:7tm_1 34 275 3.6e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189697
SMART Domains Protein: ENSMUSP00000139787
Gene: ENSMUSG00000026271

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 147 5.7e-6 PFAM
Pfam:7tm_1 34 147 1.4e-24 PFAM
Meta Mutation Damage Score 0.8052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
6430571L13Rik A T 9: 107,342,479 T44S probably damaging Het
9530053A07Rik T A 7: 28,154,555 I1648K probably benign Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ctif A T 18: 75,611,757 L92Q possibly damaging Het
Dnah11 C A 12: 117,911,023 D4036Y probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnah6 G C 6: 73,032,633 A3725G probably benign Het
Ebag9 A G 15: 44,630,132 N117D probably benign Het
Elf4 C T X: 48,419,065 E158K probably benign Het
Ephb6 C T 6: 41,616,159 R444* probably null Het
Fndc1 C T 17: 7,753,584 M1505I possibly damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Kif13a T C 13: 46,825,339 D195G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ksr2 C A 5: 117,689,575 T473K probably damaging Het
Kxd1 T C 8: 70,513,982 probably null Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Macf1 A T 4: 123,527,305 L52* probably null Het
Mrgprb5 A G 7: 48,168,913 S25P probably benign Het
Nucb1 T C 7: 45,498,876 H171R probably benign Het
Olfr1049 A G 2: 86,254,841 M284T possibly damaging Het
Olfr1098 A G 2: 86,923,029 F168L possibly damaging Het
Olfr1234 A T 2: 89,362,950 F160I probably benign Het
Olfr689 G A 7: 105,314,400 C132Y probably damaging Het
Olfr934 A G 9: 38,982,465 L193P probably damaging Het
Prkdc A T 16: 15,768,025 I2476F probably damaging Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ralgapa1 T G 12: 55,695,143 probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc28a3 C T 13: 58,573,439 probably benign Het
Slc44a4 A G 17: 34,921,680 D283G probably benign Het
Slc6a9 A G 4: 117,856,803 I105V probably benign Het
Smgc A G 15: 91,842,003 T51A possibly damaging Het
Smyd5 T A 6: 85,438,190 L60H probably damaging Het
Spred1 A T 2: 117,175,386 M210L probably benign Het
Syne2 G A 12: 76,054,978 probably null Het
Tab3 T C X: 85,615,121 I418T probably benign Het
Tbc1d12 A T 19: 38,896,034 E343V possibly damaging Het
Tktl2 T A 8: 66,513,245 I485N probably damaging Het
Tmem181a T A 17: 6,280,619 Y51* probably null Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Trip11 A G 12: 101,893,694 I307T possibly damaging Het
Ttf1 T C 2: 29,065,487 S288P possibly damaging Het
Zfp395 G T 14: 65,391,293 R198L possibly damaging Het
Other mutations in Gpr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Gpr35 APN 1 92982872 missense probably damaging 0.99
IGL03102:Gpr35 APN 1 92982577 missense probably benign 0.00
PIT4280001:Gpr35 UTSW 1 92982634 missense probably damaging 1.00
R0015:Gpr35 UTSW 1 92983232 missense probably damaging 1.00
R0412:Gpr35 UTSW 1 92982784 missense probably benign 0.01
R1203:Gpr35 UTSW 1 92983148 missense probably damaging 0.98
R1515:Gpr35 UTSW 1 92983048 missense probably damaging 1.00
R2872:Gpr35 UTSW 1 92983126 missense probably benign 0.34
R2872:Gpr35 UTSW 1 92983126 missense probably benign 0.34
R3498:Gpr35 UTSW 1 92983391 missense probably damaging 1.00
R4732:Gpr35 UTSW 1 92983385 missense probably damaging 1.00
R4733:Gpr35 UTSW 1 92983385 missense probably damaging 1.00
R5270:Gpr35 UTSW 1 92982577 missense probably benign 0.00
R5969:Gpr35 UTSW 1 92983220 missense probably damaging 1.00
R6769:Gpr35 UTSW 1 92982704 missense probably damaging 0.97
R6771:Gpr35 UTSW 1 92982704 missense probably damaging 0.97
R7144:Gpr35 UTSW 1 92982631 missense probably benign 0.11
R7395:Gpr35 UTSW 1 92983207 missense probably damaging 1.00
R8156:Gpr35 UTSW 1 92982715 missense probably damaging 1.00
Z1177:Gpr35 UTSW 1 92983016 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGGTCTGGGCCAACTTG -3'
(R):5'- AGATGCAGCCTCTCTAGTCCAAC -3'

Sequencing Primer
(F):5'- CAACTTGGCTGTGTTTGTCATC -3'
(R):5'- TAGTCCAACTGGGTCTCCTAGAG -3'
Posted On 2015-04-02