Incidental Mutation 'R3499:Sla2'
ID273692
Institutional Source Beutler Lab
Gene Symbol Sla2
Ensembl Gene ENSMUSG00000027636
Gene NameSrc-like-adaptor 2
SynonymsSLAP-2, A930009E21Rik, SLAP2
MMRRC Submission 040662-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3499 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156872457-156887192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156875942 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 137 (R137C)
Ref Sequence ENSEMBL: ENSMUSP00000105189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029164] [ENSMUST00000029165] [ENSMUST00000109561]
Predicted Effect probably damaging
Transcript: ENSMUST00000029164
AA Change: R137C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029164
Gene: ENSMUSG00000027636
AA Change: R137C

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
SH3 34 90 2.9e-4 SMART
SH2 91 181 4.47e-30 SMART
low complexity region 203 211 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029165
SMART Domains Protein: ENSMUSP00000029165
Gene: ENSMUSG00000027637

DomainStartEndE-ValueType
Pfam:Rab5ip 44 123 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109561
AA Change: R137C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105189
Gene: ENSMUSG00000027636
AA Change: R137C

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
SH3 34 90 2.9e-4 SMART
SH2 91 181 4.47e-30 SMART
low complexity region 203 211 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152551
Meta Mutation Damage Score 0.3138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLAP family of adapter proteins. The encoded protein may play an important receptor-proximal role in downregulating T and B cell-mediated responses and inhibits antigen receptor-induced calcium mobilization. This protein interacts with Cas-Br-M (murine) ecotropic retroviral transforming sequence c. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
6430571L13Rik A T 9: 107,342,479 T44S probably damaging Het
9530053A07Rik T A 7: 28,154,555 I1648K probably benign Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ctif A T 18: 75,611,757 L92Q possibly damaging Het
Dnah11 C A 12: 117,911,023 D4036Y probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnah6 G C 6: 73,032,633 A3725G probably benign Het
Ebag9 A G 15: 44,630,132 N117D probably benign Het
Elf4 C T X: 48,419,065 E158K probably benign Het
Ephb6 C T 6: 41,616,159 R444* probably null Het
Fndc1 C T 17: 7,753,584 M1505I possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Kif13a T C 13: 46,825,339 D195G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ksr2 C A 5: 117,689,575 T473K probably damaging Het
Kxd1 T C 8: 70,513,982 probably null Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Macf1 A T 4: 123,527,305 L52* probably null Het
Mrgprb5 A G 7: 48,168,913 S25P probably benign Het
Nucb1 T C 7: 45,498,876 H171R probably benign Het
Olfr1049 A G 2: 86,254,841 M284T possibly damaging Het
Olfr1098 A G 2: 86,923,029 F168L possibly damaging Het
Olfr1234 A T 2: 89,362,950 F160I probably benign Het
Olfr689 G A 7: 105,314,400 C132Y probably damaging Het
Olfr934 A G 9: 38,982,465 L193P probably damaging Het
Prkdc A T 16: 15,768,025 I2476F probably damaging Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ralgapa1 T G 12: 55,695,143 probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Slc28a3 C T 13: 58,573,439 probably benign Het
Slc44a4 A G 17: 34,921,680 D283G probably benign Het
Slc6a9 A G 4: 117,856,803 I105V probably benign Het
Smgc A G 15: 91,842,003 T51A possibly damaging Het
Smyd5 T A 6: 85,438,190 L60H probably damaging Het
Spred1 A T 2: 117,175,386 M210L probably benign Het
Syne2 G A 12: 76,054,978 probably null Het
Tab3 T C X: 85,615,121 I418T probably benign Het
Tbc1d12 A T 19: 38,896,034 E343V possibly damaging Het
Tktl2 T A 8: 66,513,245 I485N probably damaging Het
Tmem181a T A 17: 6,280,619 Y51* probably null Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Trip11 A G 12: 101,893,694 I307T possibly damaging Het
Ttf1 T C 2: 29,065,487 S288P possibly damaging Het
Zfp395 G T 14: 65,391,293 R198L possibly damaging Het
Other mutations in Sla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0109:Sla2 UTSW 2 156883587 critical splice donor site probably null
R0109:Sla2 UTSW 2 156883587 critical splice donor site probably null
R0992:Sla2 UTSW 2 156874472 missense probably damaging 0.99
R2250:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2257:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2377:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2378:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2379:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2442:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2443:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2843:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3416:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3417:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3792:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3793:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3878:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R5664:Sla2 UTSW 2 156874999 missense probably benign 0.04
R6784:Sla2 UTSW 2 156883669 missense unknown
R7356:Sla2 UTSW 2 156878703 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTGACTATCTCCTAGGCCCC -3'
(R):5'- ACAGCCGATATTTAATGCTCACC -3'

Sequencing Primer
(F):5'- CTCATCCAGTCTGCAGTGG -3'
(R):5'- TAATGCTCACCCATCCTGAGG -3'
Posted On2015-04-02