Mutagenetix > Incidental Mutations

Incidental Mutation 'R3499:Ephb6'

273698

Institutional Source

Beutler Lab

Gene Symbol

Ephb6

Ensembl Gene

ENSMUSG00000029869

Gene Name

Eph receptor B6

Synonyms

Cekl, Mep

MMRRC Submission

040662-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.700) question?

Stock #

R3499 (G1)

Quality Score

112

Status

Validated

Chromosome

Chromosomal Location

41605482-41620509 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 41616159 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 444 (R444*)

Ref Sequence

ENSEMBL: ENSMUSP00000110380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]

Predicted Effect

probably benign
Transcript: ENSMUST00000031902

SMART Domains

Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868

Domain	Start	End	E-Value	Type
ANK	44	74	2.39e2	SMART
ANK	78	107	6.17e-1	SMART
ANK	116	145	3.06e-5	SMART
ANK	162	191	1.85e-4	SMART
Blast:ANK	195	223	3e-10	BLAST
ANK	238	267	2.47e2	SMART
Pfam:Ion_trans	327	589	9.8e-18	PFAM
low complexity region	680	695	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000114732
AA Change: R444*

SMART Domains

Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: R444*

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
EPH_lbd	34	227	2.18e-100	SMART
low complexity region	242	255	N/A	INTRINSIC
Pfam:GCC2_GCC3	299	341	1.9e-9	PFAM
FN3	365	462	3.59e-3	SMART
FN3	481	562	3.73e-10	SMART
Pfam:EphA2_TM	589	660	3.4e-16	PFAM
Pfam:Pkinase	663	908	1.4e-29	PFAM
Pfam:Pkinase_Tyr	663	908	1.1e-67	PFAM
SAM	938	1005	1e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167082

Predicted Effect

probably benign
Transcript: ENSMUST00000167497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170624

Predicted Effect

probably benign
Transcript: ENSMUST00000201471

SMART Domains

Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868

Domain	Start	End	E-Value	Type
ANK	44	74	2.39e2	SMART
ANK	78	107	6.17e-1	SMART
ANK	116	145	3.06e-5	SMART
ANK	162	191	1.85e-4	SMART
Blast:ANK	195	223	3e-10	BLAST
ANK	238	267	2.47e2	SMART
Pfam:Ion_trans	327	589	9.8e-18	PFAM
low complexity region	680	695	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.7%
20x: 96.3%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
6430571L13Rik	A	T	9: 107,342,479	T44S	probably damaging	Het
9530053A07Rik	T	A	7: 28,154,555	I1648K	probably benign	Het
Cass4	C	T	2: 172,432,558	P753L	probably damaging	Het
Ctif	A	T	18: 75,611,757	L92Q	possibly damaging	Het
Dnah11	C	A	12: 117,911,023	D4036Y	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Dnah6	G	C	6: 73,032,633	A3725G	probably benign	Het
Ebag9	A	G	15: 44,630,132	N117D	probably benign	Het
Elf4	C	T	X: 48,419,065	E158K	probably benign	Het
Fndc1	C	T	17: 7,753,584	M1505I	possibly damaging	Het
Gpr35	A	G	1: 92,983,391	Y275C	probably damaging	Het
Hmcn1	A	T	1: 150,605,102	I4441N	probably damaging	Het
Kif13a	T	C	13: 46,825,339	D195G	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Ksr2	C	A	5: 117,689,575	T473K	probably damaging	Het
Kxd1	T	C	8: 70,513,982		probably null	Het
Lyplal1	A	G	1: 186,088,660	S197P	possibly damaging	Het
Macf1	A	T	4: 123,527,305	L52*	probably null	Het
Mrgprb5	A	G	7: 48,168,913	S25P	probably benign	Het
Nucb1	T	C	7: 45,498,876	H171R	probably benign	Het
Olfr1049	A	G	2: 86,254,841	M284T	possibly damaging	Het
Olfr1098	A	G	2: 86,923,029	F168L	possibly damaging	Het
Olfr1234	A	T	2: 89,362,950	F160I	probably benign	Het
Olfr689	G	A	7: 105,314,400	C132Y	probably damaging	Het
Olfr934	A	G	9: 38,982,465	L193P	probably damaging	Het
Prkdc	A	T	16: 15,768,025	I2476F	probably damaging	Het
Ptprf	A	T	4: 118,224,930	I1037N	probably damaging	Het
Ralgapa1	T	G	12: 55,695,143		probably benign	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Slc28a3	C	T	13: 58,573,439		probably benign	Het
Slc44a4	A	G	17: 34,921,680	D283G	probably benign	Het
Slc6a9	A	G	4: 117,856,803	I105V	probably benign	Het
Smgc	A	G	15: 91,842,003	T51A	possibly damaging	Het
Smyd5	T	A	6: 85,438,190	L60H	probably damaging	Het
Spred1	A	T	2: 117,175,386	M210L	probably benign	Het
Syne2	G	A	12: 76,054,978		probably null	Het
Tab3	T	C	X: 85,615,121	I418T	probably benign	Het
Tbc1d12	A	T	19: 38,896,034	E343V	possibly damaging	Het
Tktl2	T	A	8: 66,513,245	I485N	probably damaging	Het
Tmem181a	T	A	17: 6,280,619	Y51*	probably null	Het
Tmem229b-ps	C	T	10: 53,475,127		noncoding transcript	Het
Trip11	A	G	12: 101,893,694	I307T	possibly damaging	Het
Ttf1	T	C	2: 29,065,487	S288P	possibly damaging	Het
Zfp395	G	T	14: 65,391,293	R198L	possibly damaging	Het

Other mutations in Ephb6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Ephb6	APN	6	41615911	unclassified	probably benign
IGL01691:Ephb6	APN	6	41614515	missense	probably benign	0.26
IGL02052:Ephb6	APN	6	41613322	missense	probably benign
IGL02079:Ephb6	APN	6	41616014	missense	possibly damaging	0.57
IGL03089:Ephb6	APN	6	41614174	missense	probably damaging	1.00
P4748:Ephb6	UTSW	6	41617285	missense	probably damaging	0.96
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0974:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1610:Ephb6	UTSW	6	41614373	nonsense	probably null
R1658:Ephb6	UTSW	6	41614245	missense	probably damaging	1.00
R1687:Ephb6	UTSW	6	41617366	missense	probably benign	0.08
R1733:Ephb6	UTSW	6	41619720	missense	probably benign	0.10
R2191:Ephb6	UTSW	6	41616085	missense	possibly damaging	0.82
R2439:Ephb6	UTSW	6	41618735	missense	probably benign	0.31
R2915:Ephb6	UTSW	6	41614238	missense	probably damaging	1.00
R3020:Ephb6	UTSW	6	41614521	missense	probably damaging	1.00
R4606:Ephb6	UTSW	6	41616574	missense	probably benign	0.15
R4663:Ephb6	UTSW	6	41617865	missense	probably damaging	1.00
R4668:Ephb6	UTSW	6	41614602	missense	possibly damaging	0.91
R4762:Ephb6	UTSW	6	41618160	missense	probably damaging	0.99
R4767:Ephb6	UTSW	6	41614185	missense	possibly damaging	0.81
R4780:Ephb6	UTSW	6	41616139	missense	probably damaging	1.00
R4846:Ephb6	UTSW	6	41616809	missense	probably benign
R4851:Ephb6	UTSW	6	41618145	missense	probably benign	0.00
R5016:Ephb6	UTSW	6	41618107	missense	probably benign	0.01
R5122:Ephb6	UTSW	6	41613404	missense	probably benign	0.00
R5313:Ephb6	UTSW	6	41616793	missense	possibly damaging	0.68
R5615:Ephb6	UTSW	6	41619291	missense	probably benign
R5623:Ephb6	UTSW	6	41616481	missense	probably benign	0.20
R5686:Ephb6	UTSW	6	41619704	missense	possibly damaging	0.57
R5840:Ephb6	UTSW	6	41615573	missense	possibly damaging	0.94
R6147:Ephb6	UTSW	6	41616781	missense	probably damaging	1.00
R6645:Ephb6	UTSW	6	41617272	missense	probably benign	0.01
R6730:Ephb6	UTSW	6	41617374	nonsense	probably null
R7412:Ephb6	UTSW	6	41620239	missense	probably damaging	1.00
R7442:Ephb6	UTSW	6	41618047	splice site	probably null
R7759:Ephb6	UTSW	6	41614605	missense	probably benign	0.00
R7857:Ephb6	UTSW	6	41613397	missense	probably benign
R8425:Ephb6	UTSW	6	41618646	missense	probably damaging	0.98
X0027:Ephb6	UTSW	6	41620080	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCCCGGGAGCTATGGTTTG -3'
(R):5'- CAGGCTGGCTGGAAATCAGG -3'

Sequencing Primer
(F):5'- ACTCATGCTGCACTGGC -3'
(R):5'- GCTGGAAATCAGGCATGGG -3'

Posted On

2015-04-02