Incidental Mutation 'R3499:Ephb6'
ID273698
Institutional Source Beutler Lab
Gene Symbol Ephb6
Ensembl Gene ENSMUSG00000029869
Gene NameEph receptor B6
SynonymsCekl, Mep
MMRRC Submission 040662-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock #R3499 (G1)
Quality Score112
Status Validated
Chromosome6
Chromosomal Location41605482-41620509 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 41616159 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 444 (R444*)
Ref Sequence ENSEMBL: ENSMUSP00000110380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]
Predicted Effect probably benign
Transcript: ENSMUST00000031902
SMART Domains Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114732
AA Change: R444*
SMART Domains Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: R444*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
EPH_lbd 34 227 2.18e-100 SMART
low complexity region 242 255 N/A INTRINSIC
Pfam:GCC2_GCC3 299 341 1.9e-9 PFAM
FN3 365 462 3.59e-3 SMART
FN3 481 562 3.73e-10 SMART
Pfam:EphA2_TM 589 660 3.4e-16 PFAM
Pfam:Pkinase 663 908 1.4e-29 PFAM
Pfam:Pkinase_Tyr 663 908 1.1e-67 PFAM
SAM 938 1005 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167082
Predicted Effect probably benign
Transcript: ENSMUST00000167497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170624
Predicted Effect probably benign
Transcript: ENSMUST00000201471
SMART Domains Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
6430571L13Rik A T 9: 107,342,479 T44S probably damaging Het
9530053A07Rik T A 7: 28,154,555 I1648K probably benign Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ctif A T 18: 75,611,757 L92Q possibly damaging Het
Dnah11 C A 12: 117,911,023 D4036Y probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnah6 G C 6: 73,032,633 A3725G probably benign Het
Ebag9 A G 15: 44,630,132 N117D probably benign Het
Elf4 C T X: 48,419,065 E158K probably benign Het
Fndc1 C T 17: 7,753,584 M1505I possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Kif13a T C 13: 46,825,339 D195G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ksr2 C A 5: 117,689,575 T473K probably damaging Het
Kxd1 T C 8: 70,513,982 probably null Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Macf1 A T 4: 123,527,305 L52* probably null Het
Mrgprb5 A G 7: 48,168,913 S25P probably benign Het
Nucb1 T C 7: 45,498,876 H171R probably benign Het
Olfr1049 A G 2: 86,254,841 M284T possibly damaging Het
Olfr1098 A G 2: 86,923,029 F168L possibly damaging Het
Olfr1234 A T 2: 89,362,950 F160I probably benign Het
Olfr689 G A 7: 105,314,400 C132Y probably damaging Het
Olfr934 A G 9: 38,982,465 L193P probably damaging Het
Prkdc A T 16: 15,768,025 I2476F probably damaging Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ralgapa1 T G 12: 55,695,143 probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc28a3 C T 13: 58,573,439 probably benign Het
Slc44a4 A G 17: 34,921,680 D283G probably benign Het
Slc6a9 A G 4: 117,856,803 I105V probably benign Het
Smgc A G 15: 91,842,003 T51A possibly damaging Het
Smyd5 T A 6: 85,438,190 L60H probably damaging Het
Spred1 A T 2: 117,175,386 M210L probably benign Het
Syne2 G A 12: 76,054,978 probably null Het
Tab3 T C X: 85,615,121 I418T probably benign Het
Tbc1d12 A T 19: 38,896,034 E343V possibly damaging Het
Tktl2 T A 8: 66,513,245 I485N probably damaging Het
Tmem181a T A 17: 6,280,619 Y51* probably null Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Trip11 A G 12: 101,893,694 I307T possibly damaging Het
Ttf1 T C 2: 29,065,487 S288P possibly damaging Het
Zfp395 G T 14: 65,391,293 R198L possibly damaging Het
Other mutations in Ephb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Ephb6 APN 6 41615911 unclassified probably benign
IGL01691:Ephb6 APN 6 41614515 missense probably benign 0.26
IGL02052:Ephb6 APN 6 41613322 missense probably benign
IGL02079:Ephb6 APN 6 41616014 missense possibly damaging 0.57
IGL03089:Ephb6 APN 6 41614174 missense probably damaging 1.00
P4748:Ephb6 UTSW 6 41617285 missense probably damaging 0.96
R0022:Ephb6 UTSW 6 41614569 missense probably damaging 0.98
R0022:Ephb6 UTSW 6 41614569 missense probably damaging 0.98
R0106:Ephb6 UTSW 6 41619594 unclassified probably benign
R0106:Ephb6 UTSW 6 41619594 unclassified probably benign
R0973:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R0973:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R0974:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R1465:Ephb6 UTSW 6 41616106 missense probably damaging 1.00
R1465:Ephb6 UTSW 6 41616106 missense probably damaging 1.00
R1610:Ephb6 UTSW 6 41614373 nonsense probably null
R1658:Ephb6 UTSW 6 41614245 missense probably damaging 1.00
R1687:Ephb6 UTSW 6 41617366 missense probably benign 0.08
R1733:Ephb6 UTSW 6 41619720 missense probably benign 0.10
R2191:Ephb6 UTSW 6 41616085 missense possibly damaging 0.82
R2439:Ephb6 UTSW 6 41618735 missense probably benign 0.31
R2915:Ephb6 UTSW 6 41614238 missense probably damaging 1.00
R3020:Ephb6 UTSW 6 41614521 missense probably damaging 1.00
R4606:Ephb6 UTSW 6 41616574 missense probably benign 0.15
R4663:Ephb6 UTSW 6 41617865 missense probably damaging 1.00
R4668:Ephb6 UTSW 6 41614602 missense possibly damaging 0.91
R4762:Ephb6 UTSW 6 41618160 missense probably damaging 0.99
R4767:Ephb6 UTSW 6 41614185 missense possibly damaging 0.81
R4780:Ephb6 UTSW 6 41616139 missense probably damaging 1.00
R4846:Ephb6 UTSW 6 41616809 missense probably benign
R4851:Ephb6 UTSW 6 41618145 missense probably benign 0.00
R5016:Ephb6 UTSW 6 41618107 missense probably benign 0.01
R5122:Ephb6 UTSW 6 41613404 missense probably benign 0.00
R5313:Ephb6 UTSW 6 41616793 missense possibly damaging 0.68
R5615:Ephb6 UTSW 6 41619291 missense probably benign
R5623:Ephb6 UTSW 6 41616481 missense probably benign 0.20
R5686:Ephb6 UTSW 6 41619704 missense possibly damaging 0.57
R5840:Ephb6 UTSW 6 41615573 missense possibly damaging 0.94
R6147:Ephb6 UTSW 6 41616781 missense probably damaging 1.00
R6645:Ephb6 UTSW 6 41617272 missense probably benign 0.01
R6730:Ephb6 UTSW 6 41617374 nonsense probably null
R7412:Ephb6 UTSW 6 41620239 missense probably damaging 1.00
R7442:Ephb6 UTSW 6 41618047 splice site probably null
R7759:Ephb6 UTSW 6 41614605 missense probably benign 0.00
R7857:Ephb6 UTSW 6 41613397 missense probably benign
R8425:Ephb6 UTSW 6 41618646 missense probably damaging 0.98
X0027:Ephb6 UTSW 6 41620080 makesense probably null
Predicted Primers PCR Primer
(F):5'- TCCCCGGGAGCTATGGTTTG -3'
(R):5'- CAGGCTGGCTGGAAATCAGG -3'

Sequencing Primer
(F):5'- ACTCATGCTGCACTGGC -3'
(R):5'- GCTGGAAATCAGGCATGGG -3'
Posted On2015-04-02