Incidental Mutation 'R3499:Smyd5'
ID273701
Institutional Source Beutler Lab
Gene Symbol Smyd5
Ensembl Gene ENSMUSG00000033706
Gene NameSET and MYND domain containing 5
SynonymsNN8-4AG, Rai15, Rrg1
MMRRC Submission 040662-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3499 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location85431989-85446435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85438190 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 60 (L60H)
Ref Sequence ENSEMBL: ENSMUSP00000048537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045693]
Predicted Effect probably damaging
Transcript: ENSMUST00000045693
AA Change: L60H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048537
Gene: ENSMUSG00000033706
AA Change: L60H

DomainStartEndE-ValueType
SET 21 357 8.15e-14 SMART
low complexity region 392 412 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204428
Meta Mutation Damage Score 0.1016 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
6430571L13Rik A T 9: 107,342,479 T44S probably damaging Het
9530053A07Rik T A 7: 28,154,555 I1648K probably benign Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ctif A T 18: 75,611,757 L92Q possibly damaging Het
Dnah11 C A 12: 117,911,023 D4036Y probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnah6 G C 6: 73,032,633 A3725G probably benign Het
Ebag9 A G 15: 44,630,132 N117D probably benign Het
Elf4 C T X: 48,419,065 E158K probably benign Het
Ephb6 C T 6: 41,616,159 R444* probably null Het
Fndc1 C T 17: 7,753,584 M1505I possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Kif13a T C 13: 46,825,339 D195G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ksr2 C A 5: 117,689,575 T473K probably damaging Het
Kxd1 T C 8: 70,513,982 probably null Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Macf1 A T 4: 123,527,305 L52* probably null Het
Mrgprb5 A G 7: 48,168,913 S25P probably benign Het
Nucb1 T C 7: 45,498,876 H171R probably benign Het
Olfr1049 A G 2: 86,254,841 M284T possibly damaging Het
Olfr1098 A G 2: 86,923,029 F168L possibly damaging Het
Olfr1234 A T 2: 89,362,950 F160I probably benign Het
Olfr689 G A 7: 105,314,400 C132Y probably damaging Het
Olfr934 A G 9: 38,982,465 L193P probably damaging Het
Prkdc A T 16: 15,768,025 I2476F probably damaging Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ralgapa1 T G 12: 55,695,143 probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc28a3 C T 13: 58,573,439 probably benign Het
Slc44a4 A G 17: 34,921,680 D283G probably benign Het
Slc6a9 A G 4: 117,856,803 I105V probably benign Het
Smgc A G 15: 91,842,003 T51A possibly damaging Het
Spred1 A T 2: 117,175,386 M210L probably benign Het
Syne2 G A 12: 76,054,978 probably null Het
Tab3 T C X: 85,615,121 I418T probably benign Het
Tbc1d12 A T 19: 38,896,034 E343V possibly damaging Het
Tktl2 T A 8: 66,513,245 I485N probably damaging Het
Tmem181a T A 17: 6,280,619 Y51* probably null Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Trip11 A G 12: 101,893,694 I307T possibly damaging Het
Ttf1 T C 2: 29,065,487 S288P possibly damaging Het
Zfp395 G T 14: 65,391,293 R198L possibly damaging Het
Other mutations in Smyd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03065:Smyd5 APN 6 85442164 missense possibly damaging 0.75
IGL03261:Smyd5 APN 6 85432018 missense probably benign 0.05
R0383:Smyd5 UTSW 6 85440173 nonsense probably null
R1957:Smyd5 UTSW 6 85438139 missense probably benign 0.01
R1988:Smyd5 UTSW 6 85438136 missense possibly damaging 0.93
R2049:Smyd5 UTSW 6 85444318 missense probably benign 0.01
R3552:Smyd5 UTSW 6 85442211 missense probably damaging 0.99
R5092:Smyd5 UTSW 6 85445203 unclassified probably benign
R6114:Smyd5 UTSW 6 85440262 intron probably benign
R6581:Smyd5 UTSW 6 85432023 missense probably damaging 0.99
R7191:Smyd5 UTSW 6 85440111 missense probably benign 0.10
R7868:Smyd5 UTSW 6 85444315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGCCTGAAACTACTTATCCC -3'
(R):5'- GAGCATTTTGGAGGCACCTC -3'

Sequencing Primer
(F):5'- AAACTACTTATCCCCCTGTTTCCATG -3'
(R):5'- TCCCATCGCAGGTACACAG -3'
Posted On2015-04-02