Incidental Mutation 'R3500:Pramel6'
ID273739
Institutional Source Beutler Lab
Gene Symbol Pramel6
Ensembl Gene ENSMUSG00000025838
Gene Namepreferentially expressed antigen in melanoma like 6
Synonyms
MMRRC Submission 040663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3500 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87506565-87510872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87509225 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 111 (H111R)
Ref Sequence ENSEMBL: ENSMUSP00000107198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026956] [ENSMUST00000111572]
Predicted Effect probably damaging
Transcript: ENSMUST00000026956
AA Change: H111R

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026956
Gene: ENSMUSG00000025838
AA Change: H111R

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
SCOP:d1a4ya_ 223 411 5e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111572
AA Change: H111R

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107198
Gene: ENSMUSG00000025838
AA Change: H111R

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
SCOP:d1a4ya_ 223 411 5e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150746
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Copg1 G A 6: 87,895,923 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R205H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Pramel6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Pramel6 APN 2 87510785 utr 3 prime probably benign
IGL02867:Pramel6 APN 2 87510392 missense probably damaging 0.98
IGL03212:Pramel6 APN 2 87510425 missense probably damaging 1.00
R1453:Pramel6 UTSW 2 87508573 missense possibly damaging 0.83
R1905:Pramel6 UTSW 2 87509182 missense probably damaging 1.00
R1905:Pramel6 UTSW 2 87509183 missense probably damaging 0.99
R1940:Pramel6 UTSW 2 87508732 missense probably damaging 1.00
R2057:Pramel6 UTSW 2 87508715 missense possibly damaging 0.92
R2073:Pramel6 UTSW 2 87508744 missense probably damaging 1.00
R3423:Pramel6 UTSW 2 87510796 utr 3 prime probably null
R4097:Pramel6 UTSW 2 87509353 missense probably benign 0.19
R4396:Pramel6 UTSW 2 87508530 missense probably damaging 1.00
R4538:Pramel6 UTSW 2 87508559 missense probably benign 0.02
R4719:Pramel6 UTSW 2 87510752 missense probably benign 0.00
R4779:Pramel6 UTSW 2 87509597 missense probably benign 0.01
R6054:Pramel6 UTSW 2 87508659 missense probably benign 0.07
R6457:Pramel6 UTSW 2 87509438 missense probably damaging 0.99
R6477:Pramel6 UTSW 2 87510602 missense possibly damaging 0.92
R6492:Pramel6 UTSW 2 87510422 missense probably benign 0.19
R6684:Pramel6 UTSW 2 87509404 missense probably damaging 1.00
R6983:Pramel6 UTSW 2 87509579 missense possibly damaging 0.94
R7351:Pramel6 UTSW 2 87510328 missense probably benign 0.00
R7357:Pramel6 UTSW 2 87510512 missense not run
R7748:Pramel6 UTSW 2 87508699 missense probably damaging 1.00
Z1176:Pramel6 UTSW 2 87508722 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACAGATGTAGCATTGCAGC -3'
(R):5'- TCCACTGCATCAAGTATATGGTC -3'

Sequencing Primer
(F):5'- CAGATGTAGCATTGCAGCTTATTCC -3'
(R):5'- CACTGCATCAAGTATATGGTCCATTC -3'
Posted On2015-04-02