Incidental Mutation 'R3500:Olfr1317'
ID273742
Institutional Source Beutler Lab
Gene Symbol Olfr1317
Ensembl Gene ENSMUSG00000050776
Gene Nameolfactory receptor 1317
SynonymsGA_x6K02T2Q125-73188162-73189112, MOR245-4
MMRRC Submission 040663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R3500 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112140329-112144054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112142127 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 61 (F61L)
Ref Sequence ENSEMBL: ENSMUSP00000149091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060098] [ENSMUST00000214801] [ENSMUST00000216988]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060098
AA Change: F61L

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058587
Gene: ENSMUSG00000050776
AA Change: F61L

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.1e-40 PFAM
Pfam:7tm_1 41 287 5.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213693
Predicted Effect possibly damaging
Transcript: ENSMUST00000214801
AA Change: F61L

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216988
AA Change: F61L

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.2010 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Copg1 G A 6: 87,895,923 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R205H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Olfr1317
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03294:Olfr1317 APN 2 112142173 missense probably benign 0.12
R1390:Olfr1317 UTSW 2 112142607 missense probably benign 0.35
R1404:Olfr1317 UTSW 2 112142623 missense probably benign 0.01
R1404:Olfr1317 UTSW 2 112142623 missense probably benign 0.01
R1771:Olfr1317 UTSW 2 112142720 nonsense probably null
R3894:Olfr1317 UTSW 2 112142014 missense probably benign 0.04
R4289:Olfr1317 UTSW 2 112141974 missense probably benign 0.28
R5646:Olfr1317 UTSW 2 112142683 missense possibly damaging 0.95
R6336:Olfr1317 UTSW 2 112142406 missense probably benign 0.10
R6439:Olfr1317 UTSW 2 112142164 missense probably benign 0.03
R6450:Olfr1317 UTSW 2 112142380 nonsense probably null
R6737:Olfr1317 UTSW 2 112142203 missense probably damaging 1.00
R7269:Olfr1317 UTSW 2 112142560 missense probably damaging 1.00
R7336:Olfr1317 UTSW 2 112142169 missense possibly damaging 0.80
R7597:Olfr1317 UTSW 2 112142580 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGTGCCCTTCAGGTGATAGTC -3'
(R):5'- TGACTATGAGCAACACCATCTCTG -3'

Sequencing Primer
(F):5'- CCTTCAGGTGATAGTCAACTCATGG -3'
(R):5'- TGTTCCCCCAACAGTGTGGATG -3'
Posted On2015-04-02