Mutagenetix > Incidental Mutations

Incidental Mutation 'R3500:Sdk1'

273754

Institutional Source

Beutler Lab

Gene Symbol

Sdk1

Ensembl Gene

ENSMUSG00000039683

Gene Name

sidekick cell adhesion molecule 1

Synonyms

6720466O15Rik

MMRRC Submission

040663-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R3500 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141241490-142215586 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 142006616 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000082928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]

Predicted Effect

probably benign
Transcript: ENSMUST00000074546

SMART Domains

Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683

Domain	Start	End	E-Value	Type
IGc2	28	91	4.67e-4	SMART
IGc2	121	187	1.45e-9	SMART
IGc2	214	282	1.58e-10	SMART
IG	302	387	1.8e-5	SMART
FN3	390	474	7.39e-14	SMART
FN3	490	576	8.96e-13	SMART
FN3	591	679	1.95e-4	SMART
FN3	694	776	2e-10	SMART
FN3	792	879	4.22e-9	SMART
FN3	896	983	1.41e-10	SMART
FN3	999	1084	2.7e-7	SMART
FN3	1100	1183	1.3e-9	SMART
FN3	1199	1284	2.19e-7	SMART
FN3	1300	1408	5.73e-11	SMART
FN3	1424	1509	1.79e-12	SMART
FN3	1524	1611	1.16e-11	SMART
FN3	1625	1709	1.32e-10	SMART
transmembrane domain	1730	1752	N/A	INTRINSIC
low complexity region	1806	1815	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000085774

SMART Domains

Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
IGc2	99	158	2.77e-6	SMART
IG	179	264	3.74e-3	SMART
IGc2	288	351	4.67e-4	SMART
IGc2	381	447	1.45e-9	SMART
IGc2	474	542	1.58e-10	SMART
IG	562	647	1.8e-5	SMART
FN3	650	734	7.39e-14	SMART
FN3	750	836	8.96e-13	SMART
FN3	851	939	1.95e-4	SMART
FN3	954	1036	2e-10	SMART
FN3	1052	1139	4.22e-9	SMART
FN3	1156	1243	1.41e-10	SMART
FN3	1259	1344	2.7e-7	SMART
FN3	1360	1443	1.3e-9	SMART
FN3	1459	1544	2.19e-7	SMART
FN3	1560	1668	5.73e-11	SMART
FN3	1684	1769	1.79e-12	SMART
FN3	1784	1871	1.16e-11	SMART
FN3	1885	1969	1.32e-10	SMART
transmembrane domain	1990	2012	N/A	INTRINSIC
low complexity region	2066	2075	N/A	INTRINSIC
low complexity region	2106	2118	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.7%
20x: 96.2%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	T	4: 107,891,513	R83W	probably damaging	Het
Amhr2	A	G	15: 102,447,066	D188G	probably benign	Het
Arl15	G	A	13: 113,967,692	E102K	probably damaging	Het
Atp10d	C	T	5: 72,245,723	R319C	probably damaging	Het
Cetn4	A	T	3: 37,309,960	F34I	probably benign	Het
Chd8	G	T	14: 52,205,653	H510N	probably benign	Het
Chil5	T	C	3: 106,018,220	D157G	probably damaging	Het
Clcn1	T	C	6: 42,292,995	S251P	probably damaging	Het
Clstn3	A	T	6: 124,431,711	C881S	probably benign	Het
Cnot4	G	A	6: 35,080,141		probably benign	Het
Copg1	G	A	6: 87,895,923		probably benign	Het
Eftud2	A	G	11: 102,844,180	M631T	probably damaging	Het
Elavl3	A	G	9: 22,018,744	V288A	probably damaging	Het
Fancb	A	G	X: 164,996,108	T721A	probably damaging	Het
Fat2	A	G	11: 55,260,516	F3800S	probably damaging	Het
Fgd2	T	C	17: 29,365,601	V173A	possibly damaging	Het
Gabrr1	T	C	4: 33,158,184		probably benign	Het
Gata4	C	T	14: 63,200,533	G390S	possibly damaging	Het
Gm9396	C	A	3: 130,068,495		noncoding transcript	Het
Grid2	T	C	6: 63,503,399	S66P	probably damaging	Het
Hdac9	C	A	12: 34,437,353	M16I	probably benign	Het
Kmt2c	A	T	5: 25,299,479	D3610E	probably benign	Het
Lactb2	A	T	1: 13,660,449	M1K	probably null	Het
Ldhb	T	C	6: 142,501,447	D47G	probably damaging	Het
Map3k11	A	T	19: 5,690,247	M1L	probably benign	Het
Mecom	C	T	3: 29,980,912	R205H	probably damaging	Het
Mob1b	A	G	5: 88,749,620	D129G	probably benign	Het
Nbea	A	G	3: 55,681,010	V2436A	possibly damaging	Het
Neb	T	C	2: 52,325,785	N170S	probably damaging	Het
Nedd4l	G	A	18: 65,212,860	A848T	probably damaging	Het
Nr5a1	G	A	2: 38,707,940	R282*	probably null	Het
Olfr1189	A	G	2: 88,591,941	T46A	probably damaging	Het
Olfr1224-ps1	C	T	2: 89,157,059	G39R	probably damaging	Het
Olfr1317	T	C	2: 112,142,127	F61L	possibly damaging	Het
Olfr1426	A	G	19: 12,088,057	V245A	possibly damaging	Het
Olfr589	T	C	7: 103,155,090	Y219C	probably damaging	Het
Pcdhb19	T	A	18: 37,497,479	L109*	probably null	Het
Plcg2	A	G	8: 117,612,978	M1043V	probably benign	Het
Podxl2	T	C	6: 88,842,918	D554G	probably damaging	Het
Ppp3ca	A	G	3: 136,881,512	T252A	probably benign	Het
Pramel6	A	G	2: 87,509,225	H111R	probably damaging	Het
Prr19	A	G	7: 25,303,267	E130G	probably damaging	Het
Rab44	C	T	17: 29,138,067	A57V	probably benign	Het
Rhbdl3	T	C	11: 80,319,705	F95L	probably damaging	Het
Tas2r122	T	A	6: 132,711,560	K123N	probably damaging	Het
Tbpl2	C	T	2: 24,087,139	R289Q	probably benign	Het
Trpm2	A	G	10: 77,932,302	F788L	probably benign	Het
Ttn	G	A	2: 76,730,284	L29258F	probably damaging	Het
Ttn	G	T	2: 76,761,165	F19307L	possibly damaging	Het
Vmn2r23	T	C	6: 123,713,170	I335T	possibly damaging	Het

Other mutations in Sdk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Sdk1	APN	5	142085606	missense	probably damaging	1.00
IGL00945:Sdk1	APN	5	142084613	critical splice donor site	probably null
IGL00946:Sdk1	APN	5	142084613	critical splice donor site	probably null
IGL01394:Sdk1	APN	5	141613215	missense	probably benign	0.03
IGL01398:Sdk1	APN	5	141937577	missense	probably benign	0.00
IGL01410:Sdk1	APN	5	142212120	missense	probably benign	0.30
IGL01525:Sdk1	APN	5	141999920	missense	probably damaging	1.00
IGL01548:Sdk1	APN	5	142085765	missense	possibly damaging	0.95
IGL01672:Sdk1	APN	5	142185175	missense	probably benign	0.33
IGL01676:Sdk1	APN	5	142127836	missense	probably damaging	0.99
IGL01679:Sdk1	APN	5	142046164	missense	probably benign
IGL01929:Sdk1	APN	5	141953030	missense	probably damaging	0.99
IGL01970:Sdk1	APN	5	142085682	missense	possibly damaging	0.67
IGL02016:Sdk1	APN	5	142034429	missense	possibly damaging	0.85
IGL02060:Sdk1	APN	5	141953012	missense	possibly damaging	0.79
IGL02457:Sdk1	APN	5	141953016	missense	probably damaging	1.00
IGL02634:Sdk1	APN	5	141610032	missense	probably benign	0.01
IGL02637:Sdk1	APN	5	142094572	missense	probably damaging	1.00
IGL02731:Sdk1	APN	5	142172544	missense	probably damaging	1.00
IGL03180:Sdk1	APN	5	142085742	missense	probably damaging	0.96
IGL03259:Sdk1	APN	5	141953033	nonsense	probably null
PIT4453001:Sdk1	UTSW	5	142212038	missense	probably benign	0.00
PIT4544001:Sdk1	UTSW	5	141956232	missense	probably benign	0.08
R0149:Sdk1	UTSW	5	141857054	intron	probably benign
R0173:Sdk1	UTSW	5	142173809	splice site	probably benign
R0240:Sdk1	UTSW	5	141998747	missense	probably damaging	1.00
R0240:Sdk1	UTSW	5	141998747	missense	probably damaging	1.00
R0242:Sdk1	UTSW	5	142143922	splice site	probably benign
R0245:Sdk1	UTSW	5	141954958	missense	probably benign	0.02
R0270:Sdk1	UTSW	5	142084566	missense	possibly damaging	0.79
R0398:Sdk1	UTSW	5	141962721	missense	probably benign	0.05
R0401:Sdk1	UTSW	5	142046161	missense	possibly damaging	0.55
R0501:Sdk1	UTSW	5	141937718	missense	probably benign
R0558:Sdk1	UTSW	5	142132065	missense	probably damaging	1.00
R0652:Sdk1	UTSW	5	141954958	missense	probably benign	0.02
R0834:Sdk1	UTSW	5	141242024	missense	probably benign
R0962:Sdk1	UTSW	5	142161875	missense	probably damaging	1.00
R1424:Sdk1	UTSW	5	142161866	missense	probably damaging	1.00
R1438:Sdk1	UTSW	5	142038323	missense	probably damaging	0.96
R1517:Sdk1	UTSW	5	142127836	missense	probably damaging	0.99
R1519:Sdk1	UTSW	5	141999950	missense	probably benign	0.00
R1539:Sdk1	UTSW	5	142094599	missense	probably damaging	1.00
R1574:Sdk1	UTSW	5	141998879	missense	probably benign	0.03
R1574:Sdk1	UTSW	5	141998879	missense	probably benign	0.03
R1673:Sdk1	UTSW	5	141948506	missense	possibly damaging	0.90
R1686:Sdk1	UTSW	5	142034537	missense	probably benign	0.00
R1806:Sdk1	UTSW	5	141613195	missense	probably damaging	1.00
R1806:Sdk1	UTSW	5	142161926	missense	probably benign
R1925:Sdk1	UTSW	5	142185285	missense	probably benign	0.09
R1956:Sdk1	UTSW	5	142094581	missense	probably damaging	1.00
R1976:Sdk1	UTSW	5	142143818	missense	probably damaging	1.00
R2124:Sdk1	UTSW	5	142185188	missense	possibly damaging	0.70
R2152:Sdk1	UTSW	5	141792944	missense	probably damaging	1.00
R2186:Sdk1	UTSW	5	142046292	missense	probably benign	0.00
R2187:Sdk1	UTSW	5	142114574	missense	probably damaging	1.00
R2306:Sdk1	UTSW	5	141962700	missense	probably benign	0.00
R2520:Sdk1	UTSW	5	142085771	missense	probably benign	0.19
R2698:Sdk1	UTSW	5	142212050	missense	possibly damaging	0.95
R2763:Sdk1	UTSW	5	142084551	missense	possibly damaging	0.90
R3023:Sdk1	UTSW	5	142046236	missense	probably benign
R3613:Sdk1	UTSW	5	142119686	missense	probably damaging	1.00
R3824:Sdk1	UTSW	5	141936049	missense	probably benign
R3916:Sdk1	UTSW	5	142051244	missense	probably damaging	0.98
R3917:Sdk1	UTSW	5	142051244	missense	probably damaging	0.98
R4158:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4160:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4161:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4386:Sdk1	UTSW	5	142094626	missense	probably damaging	0.99
R4649:Sdk1	UTSW	5	142006625	missense	probably damaging	1.00
R4701:Sdk1	UTSW	5	142185231	missense	probably damaging	1.00
R4780:Sdk1	UTSW	5	141959238	missense	probably damaging	0.97
R4787:Sdk1	UTSW	5	141582413	missense	probably benign
R4825:Sdk1	UTSW	5	141582294	missense	probably benign	0.11
R4853:Sdk1	UTSW	5	142146263	missense	probably damaging	1.00
R4857:Sdk1	UTSW	5	142161776	missense	probably benign	0.01
R4928:Sdk1	UTSW	5	141857003	intron	probably benign
R5111:Sdk1	UTSW	5	142127845	missense	probably damaging	1.00
R5188:Sdk1	UTSW	5	141956260	critical splice donor site	probably null
R5246:Sdk1	UTSW	5	142114562	missense	possibly damaging	0.72
R5273:Sdk1	UTSW	5	141998828	missense	probably damaging	0.99
R5484:Sdk1	UTSW	5	142100186	missense	probably damaging	1.00
R5525:Sdk1	UTSW	5	142185265	missense	possibly damaging	0.84
R5578:Sdk1	UTSW	5	141613125	nonsense	probably null
R5593:Sdk1	UTSW	5	141956124	missense	probably damaging	0.98
R5654:Sdk1	UTSW	5	141936098	missense	probably damaging	0.96
R5672:Sdk1	UTSW	5	142188145	missense	possibly damaging	0.94
R5768:Sdk1	UTSW	5	142143871	missense	probably benign	0.00
R5781:Sdk1	UTSW	5	141936048	missense	probably benign	0.00
R5846:Sdk1	UTSW	5	142114393	missense	probably damaging	1.00
R5851:Sdk1	UTSW	5	141962669	missense	probably benign	0.00
R6164:Sdk1	UTSW	5	142132069	missense	probably damaging	1.00
R6235:Sdk1	UTSW	5	142034426	missense	possibly damaging	0.85
R6364:Sdk1	UTSW	5	141962709	missense	probably benign	0.00
R6453:Sdk1	UTSW	5	142096921	missense	probably damaging	1.00
R6892:Sdk1	UTSW	5	142046298	missense	probably benign	0.00
R6996:Sdk1	UTSW	5	142212014	missense	probably benign	0.16
R7003:Sdk1	UTSW	5	142096734	missense	probably benign	0.01
R7022:Sdk1	UTSW	5	142094657	splice site	probably null
R7027:Sdk1	UTSW	5	142096726	splice site	probably null
R7098:Sdk1	UTSW	5	142096870	missense	probably damaging	0.96
R7107:Sdk1	UTSW	5	142081716	missense	probably damaging	0.99
R7203:Sdk1	UTSW	5	142046176	missense	probably benign	0.08
R7313:Sdk1	UTSW	5	141937622	missense	probably damaging	0.97
R7363:Sdk1	UTSW	5	142188142	missense	probably benign	0.05
R7375:Sdk1	UTSW	5	141998843	missense	probably benign	0.01
R7446:Sdk1	UTSW	5	142144976	missense	probably damaging	1.00
R7527:Sdk1	UTSW	5	141792976	missense	possibly damaging	0.61
R7598:Sdk1	UTSW	5	141609998	nonsense	probably null
R7747:Sdk1	UTSW	5	142084491	missense	probably damaging	1.00
R7810:Sdk1	UTSW	5	141937679	missense	probably benign
R7985:Sdk1	UTSW	5	142127847	missense	probably damaging	1.00
R8129:Sdk1	UTSW	5	142191893	missense	probably benign	0.10
R8217:Sdk1	UTSW	5	142211958	missense	possibly damaging	0.81
R8249:Sdk1	UTSW	5	142188015	critical splice acceptor site	probably null
R8376:Sdk1	UTSW	5	142158621	missense	possibly damaging	0.83
X0017:Sdk1	UTSW	5	141998780	missense	probably benign	0.00
Z1176:Sdk1	UTSW	5	141959310	missense	probably null	0.58
Z1177:Sdk1	UTSW	5	141962708	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CAAGTCCACTCTACTTCATCTGGAG -3'
(R):5'- GCAGCTCACCTCCTTGTAAG -3'

Sequencing Primer
(F):5'- CATCTGGAGTTTGCAGTCACCATG -3'
(R):5'- TAAGGTGTACTCGGTCACTGCC -3'

Posted On

2015-04-02