Mutagenetix > Incidental Mutations

Incidental Mutation 'R3500:Clcn1'

273756

Institutional Source

Beutler Lab

Gene Symbol

Clcn1

Ensembl Gene

ENSMUSG00000029862

Gene Name

chloride channel, voltage-sensitive 1

Synonyms

Clc1, SMCC1, nmf355, NMF355, Clc-1

MMRRC Submission

040663-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3500 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42286685-42315756 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 42292995 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 251 (S251P)

Ref Sequence

ENSEMBL: ENSMUSP00000031894 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031894
AA Change: S251P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: S251P

Domain	Start	End	E-Value	Type
low complexity region	121	130	N/A	INTRINSIC
Pfam:Voltage_CLC	170	572	3.2e-87	PFAM
Blast:CBS	612	662	1e-24	BLAST
low complexity region	723	747	N/A	INTRINSIC
Blast:CBS	830	877	4e-19	BLAST
low complexity region	928	950	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000163936
AA Change: S221P

SMART Domains

Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: S221P

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	261	1.2e-27	PFAM
Pfam:Voltage_CLC	258	501	3.9e-44	PFAM
PDB:2D4Z\|B	520	807	2e-47	PDB
Blast:CBS	541	591	2e-24	BLAST
Blast:CBS	759	806	3e-19	BLAST
low complexity region	857	879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164091
AA Change: S251P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862
AA Change: S251P

Domain	Start	End	E-Value	Type
low complexity region	121	130	N/A	INTRINSIC
Pfam:Voltage_CLC	170	256	2.9e-20	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000165780
AA Change: S221P

SMART Domains

Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862
AA Change: S221P

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	227	9.7e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000168660
AA Change: S218P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862
AA Change: S218P

Domain	Start	End	E-Value	Type
low complexity region	88	97	N/A	INTRINSIC
Pfam:Voltage_CLC	136	257	1.1e-22	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000169024
AA Change: S221P

SMART Domains

Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862
AA Change: S221P

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	261	2.9e-24	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000170028
AA Change: S221P

SMART Domains

Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862
AA Change: S221P

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	235	8e-22	PFAM

Meta Mutation Damage Score

0.2611

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.7%
20x: 96.2%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	T	4: 107,891,513	R83W	probably damaging	Het
Amhr2	A	G	15: 102,447,066	D188G	probably benign	Het
Arl15	G	A	13: 113,967,692	E102K	probably damaging	Het
Atp10d	C	T	5: 72,245,723	R319C	probably damaging	Het
Cetn4	A	T	3: 37,309,960	F34I	probably benign	Het
Chd8	G	T	14: 52,205,653	H510N	probably benign	Het
Chil5	T	C	3: 106,018,220	D157G	probably damaging	Het
Clstn3	A	T	6: 124,431,711	C881S	probably benign	Het
Cnot4	G	A	6: 35,080,141		probably benign	Het
Copg1	G	A	6: 87,895,923		probably benign	Het
Eftud2	A	G	11: 102,844,180	M631T	probably damaging	Het
Elavl3	A	G	9: 22,018,744	V288A	probably damaging	Het
Fancb	A	G	X: 164,996,108	T721A	probably damaging	Het
Fat2	A	G	11: 55,260,516	F3800S	probably damaging	Het
Fgd2	T	C	17: 29,365,601	V173A	possibly damaging	Het
Gabrr1	T	C	4: 33,158,184		probably benign	Het
Gata4	C	T	14: 63,200,533	G390S	possibly damaging	Het
Gm9396	C	A	3: 130,068,495		noncoding transcript	Het
Grid2	T	C	6: 63,503,399	S66P	probably damaging	Het
Hdac9	C	A	12: 34,437,353	M16I	probably benign	Het
Kmt2c	A	T	5: 25,299,479	D3610E	probably benign	Het
Lactb2	A	T	1: 13,660,449	M1K	probably null	Het
Ldhb	T	C	6: 142,501,447	D47G	probably damaging	Het
Map3k11	A	T	19: 5,690,247	M1L	probably benign	Het
Mecom	C	T	3: 29,980,912	R205H	probably damaging	Het
Mob1b	A	G	5: 88,749,620	D129G	probably benign	Het
Nbea	A	G	3: 55,681,010	V2436A	possibly damaging	Het
Neb	T	C	2: 52,325,785	N170S	probably damaging	Het
Nedd4l	G	A	18: 65,212,860	A848T	probably damaging	Het
Nr5a1	G	A	2: 38,707,940	R282*	probably null	Het
Olfr1189	A	G	2: 88,591,941	T46A	probably damaging	Het
Olfr1224-ps1	C	T	2: 89,157,059	G39R	probably damaging	Het
Olfr1317	T	C	2: 112,142,127	F61L	possibly damaging	Het
Olfr1426	A	G	19: 12,088,057	V245A	possibly damaging	Het
Olfr589	T	C	7: 103,155,090	Y219C	probably damaging	Het
Pcdhb19	T	A	18: 37,497,479	L109*	probably null	Het
Plcg2	A	G	8: 117,612,978	M1043V	probably benign	Het
Podxl2	T	C	6: 88,842,918	D554G	probably damaging	Het
Ppp3ca	A	G	3: 136,881,512	T252A	probably benign	Het
Pramel6	A	G	2: 87,509,225	H111R	probably damaging	Het
Prr19	A	G	7: 25,303,267	E130G	probably damaging	Het
Rab44	C	T	17: 29,138,067	A57V	probably benign	Het
Rhbdl3	T	C	11: 80,319,705	F95L	probably damaging	Het
Sdk1	G	T	5: 142,006,616		probably benign	Het
Tas2r122	T	A	6: 132,711,560	K123N	probably damaging	Het
Tbpl2	C	T	2: 24,087,139	R289Q	probably benign	Het
Trpm2	A	G	10: 77,932,302	F788L	probably benign	Het
Ttn	G	A	2: 76,730,284	L29258F	probably damaging	Het
Ttn	G	T	2: 76,761,165	F19307L	possibly damaging	Het
Vmn2r23	T	C	6: 123,713,170	I335T	possibly damaging	Het

Other mutations in Clcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Clcn1	APN	6	42291703	missense	probably damaging	1.00
IGL01732:Clcn1	APN	6	42310672	splice site	probably benign
IGL02055:Clcn1	APN	6	42307555	missense	probably damaging	1.00
IGL02507:Clcn1	APN	6	42307073	splice site	probably benign
IGL02649:Clcn1	APN	6	42298829	missense	probably damaging	1.00
IGL02739:Clcn1	APN	6	42286780	unclassified	probably null
IGL03148:Clcn1	APN	6	42299991	critical splice donor site	probably null
IGL03190:Clcn1	APN	6	42290103	missense	probably benign	0.02
IGL03327:Clcn1	APN	6	42311219	missense	probably benign	0.00
IGL03346:Clcn1	APN	6	42311219	missense	probably benign	0.00
maimed	UTSW	6	42298820	missense	probably damaging	1.00
R0167:Clcn1	UTSW	6	42286836	missense	probably damaging	1.00
R0323:Clcn1	UTSW	6	42310140	missense	probably damaging	0.99
R0491:Clcn1	UTSW	6	42310581	missense	probably benign
R0573:Clcn1	UTSW	6	42313045	splice site	probably null
R0615:Clcn1	UTSW	6	42305575	missense	probably damaging	1.00
R0944:Clcn1	UTSW	6	42313141	missense	probably benign	0.00
R1562:Clcn1	UTSW	6	42300235	missense	probably benign	0.29
R1566:Clcn1	UTSW	6	42291440	missense	possibly damaging	0.58
R1692:Clcn1	UTSW	6	42313098	missense	possibly damaging	0.67
R1728:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1729:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1772:Clcn1	UTSW	6	42294145	missense	probably damaging	1.00
R1784:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1793:Clcn1	UTSW	6	42298926	critical splice donor site	probably null
R1861:Clcn1	UTSW	6	42313991	missense	possibly damaging	0.63
R1864:Clcn1	UTSW	6	42305541	missense	probably damaging	1.00
R1865:Clcn1	UTSW	6	42305541	missense	probably damaging	1.00
R2356:Clcn1	UTSW	6	42291625	missense	probably damaging	1.00
R2403:Clcn1	UTSW	6	42313112	missense	probably damaging	0.99
R2987:Clcn1	UTSW	6	42298850	missense	probably damaging	1.00
R3082:Clcn1	UTSW	6	42290178	missense	probably damaging	0.98
R3747:Clcn1	UTSW	6	42299915	missense	probably damaging	1.00
R3748:Clcn1	UTSW	6	42299915	missense	probably damaging	1.00
R4041:Clcn1	UTSW	6	42309968	missense	probably damaging	1.00
R4749:Clcn1	UTSW	6	42290197	splice site	probably null
R4836:Clcn1	UTSW	6	42309964	missense	probably damaging	0.96
R5021:Clcn1	UTSW	6	42310988	nonsense	probably null
R5085:Clcn1	UTSW	6	42313880	missense	probably benign	0.41
R5528:Clcn1	UTSW	6	42300341	missense	probably benign	0.01
R5628:Clcn1	UTSW	6	42298889	missense	probably damaging	0.96
R5678:Clcn1	UTSW	6	42307265	missense	probably damaging	1.00
R5943:Clcn1	UTSW	6	42292966	missense	probably damaging	1.00
R6053:Clcn1	UTSW	6	42300274	nonsense	probably null
R6175:Clcn1	UTSW	6	42314162	missense	probably damaging	1.00
R6394:Clcn1	UTSW	6	42307590	missense	possibly damaging	0.84
R6394:Clcn1	UTSW	6	42313238	missense	possibly damaging	0.82
R7012:Clcn1	UTSW	6	42290608	missense	probably benign	0.01
R7020:Clcn1	UTSW	6	42298820	missense	probably damaging	1.00
R7048:Clcn1	UTSW	6	42307543	missense	probably damaging	1.00
R7212:Clcn1	UTSW	6	42291389	missense	possibly damaging	0.46
R7225:Clcn1	UTSW	6	42293462	missense	probably damaging	1.00
R7264:Clcn1	UTSW	6	42298838	missense	probably damaging	1.00
R7636:Clcn1	UTSW	6	42291334	nonsense	probably null
R7663:Clcn1	UTSW	6	42310063	missense	possibly damaging	0.79
Z1088:Clcn1	UTSW	6	42300360	missense	probably benign	0.40
Z1088:Clcn1	UTSW	6	42307256	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTAGGCTGTGGCATTGTC -3'
(R):5'- TATGGCTAGGATCAGCAGGC -3'

Sequencing Primer
(F):5'- CCTCGAATGAGACTCCTTTAAGG -3'
(R):5'- CTAGGATCAGCAGGCAGGGC -3'

Posted On

2015-04-02