Mutagenetix > Incidental Mutation

Incidental Mutation 'R3500:Vmn2r23'

273760

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

040663-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R3500 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123713170 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 335 (I335T)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172391
AA Change: I335T

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: I335T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.7%
20x: 96.2%

Validation Efficiency

98% (53/54)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	T	4: 107,891,513	R83W	probably damaging	Het
Amhr2	A	G	15: 102,447,066	D188G	probably benign	Het
Arl15	G	A	13: 113,967,692	E102K	probably damaging	Het
Atp10d	C	T	5: 72,245,723	R319C	probably damaging	Het
Cetn4	A	T	3: 37,309,960	F34I	probably benign	Het
Chd8	G	T	14: 52,205,653	H510N	probably benign	Het
Chil5	T	C	3: 106,018,220	D157G	probably damaging	Het
Clcn1	T	C	6: 42,292,995	S251P	probably damaging	Het
Clstn3	A	T	6: 124,431,711	C881S	probably benign	Het
Cnot4	G	A	6: 35,080,141		probably benign	Het
Copg1	G	A	6: 87,895,923		probably benign	Het
Eftud2	A	G	11: 102,844,180	M631T	probably damaging	Het
Elavl3	A	G	9: 22,018,744	V288A	probably damaging	Het
Fancb	A	G	X: 164,996,108	T721A	probably damaging	Het
Fat2	A	G	11: 55,260,516	F3800S	probably damaging	Het
Fgd2	T	C	17: 29,365,601	V173A	possibly damaging	Het
Gabrr1	T	C	4: 33,158,184		probably benign	Het
Gata4	C	T	14: 63,200,533	G390S	possibly damaging	Het
Gm9396	C	A	3: 130,068,495		noncoding transcript	Het
Grid2	T	C	6: 63,503,399	S66P	probably damaging	Het
Hdac9	C	A	12: 34,437,353	M16I	probably benign	Het
Kmt2c	A	T	5: 25,299,479	D3610E	probably benign	Het
Lactb2	A	T	1: 13,660,449	M1K	probably null	Het
Ldhb	T	C	6: 142,501,447	D47G	probably damaging	Het
Map3k11	A	T	19: 5,690,247	M1L	probably benign	Het
Mecom	C	T	3: 29,980,912	R205H	probably damaging	Het
Mob1b	A	G	5: 88,749,620	D129G	probably benign	Het
Nbea	A	G	3: 55,681,010	V2436A	possibly damaging	Het
Neb	T	C	2: 52,325,785	N170S	probably damaging	Het
Nedd4l	G	A	18: 65,212,860	A848T	probably damaging	Het
Nr5a1	G	A	2: 38,707,940	R282*	probably null	Het
Olfr1189	A	G	2: 88,591,941	T46A	probably damaging	Het
Olfr1224-ps1	C	T	2: 89,157,059	G39R	probably damaging	Het
Olfr1317	T	C	2: 112,142,127	F61L	possibly damaging	Het
Olfr1426	A	G	19: 12,088,057	V245A	possibly damaging	Het
Olfr589	T	C	7: 103,155,090	Y219C	probably damaging	Het
Pcdhb19	T	A	18: 37,497,479	L109*	probably null	Het
Plcg2	A	G	8: 117,612,978	M1043V	probably benign	Het
Podxl2	T	C	6: 88,842,918	D554G	probably damaging	Het
Ppp3ca	A	G	3: 136,881,512	T252A	probably benign	Het
Pramel6	A	G	2: 87,509,225	H111R	probably damaging	Het
Prr19	A	G	7: 25,303,267	E130G	probably damaging	Het
Rab44	C	T	17: 29,138,067	A57V	probably benign	Het
Rhbdl3	T	C	11: 80,319,705	F95L	probably damaging	Het
Sdk1	G	T	5: 142,006,616		probably benign	Het
Tas2r122	T	A	6: 132,711,560	K123N	probably damaging	Het
Tbpl2	C	T	2: 24,087,139	R289Q	probably benign	Het
Trpm2	A	G	10: 77,932,302	F788L	probably benign	Het
Ttn	G	A	2: 76,730,284	L29258F	probably damaging	Het
Ttn	G	T	2: 76,761,165	F19307L	possibly damaging	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GGCATTTGGTGACACATATTCTC -3'
(R):5'- AGCAGCATGGACTTTGTAGC -3'

Sequencing Primer
(F):5'- TGGTGACACATATTCTCTTCTGAG -3'
(R):5'- CAGCATGGACTTTGTAGCTCATAG -3'

Posted On

2015-04-02