Mutagenetix > Incidental Mutations

Incidental Mutation 'R3500:Hdac9'

273774

Institutional Source

Beutler Lab

Gene Symbol

Hdac9

Ensembl Gene

ENSMUSG00000004698

Gene Name

histone deacetylase 9

Synonyms

Hdac7b, HDRP, Mitr, D030072B18Rik

MMRRC Submission

040663-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3500 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34047580-34917095 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 34437353 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 16 (M16I)

Ref Sequence

ENSEMBL: ENSMUSP00000147903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110819] [ENSMUST00000209463] [ENSMUST00000209667] [ENSMUST00000209750] [ENSMUST00000209902] [ENSMUST00000209990] [ENSMUST00000210724] [ENSMUST00000211107] [ENSMUST00000211752]

Predicted Effect

probably benign
Transcript: ENSMUST00000110819
AA Change: M16I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106443
Gene: ENSMUSG00000004698
AA Change: M16I

Domain	Start	End	E-Value	Type
Pfam:HDAC4_Gln	37	124	5.4e-36	PFAM
low complexity region	260	284	N/A	INTRINSIC
low complexity region	370	382	N/A	INTRINSIC
low complexity region	389	400	N/A	INTRINSIC
low complexity region	464	480	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209463
AA Change: M16I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000209667
AA Change: M16I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000209750
AA Change: M16I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000209902
AA Change: M16I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000209990
AA Change: M16I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000210724
AA Change: M16I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

probably benign
Transcript: ENSMUST00000211107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211632

Predicted Effect

probably benign
Transcript: ENSMUST00000211752
AA Change: M37I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.7%
20x: 96.2%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display age dependent cardiac hypertrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	T	4: 107,891,513	R83W	probably damaging	Het
Amhr2	A	G	15: 102,447,066	D188G	probably benign	Het
Arl15	G	A	13: 113,967,692	E102K	probably damaging	Het
Atp10d	C	T	5: 72,245,723	R319C	probably damaging	Het
Cetn4	A	T	3: 37,309,960	F34I	probably benign	Het
Chd8	G	T	14: 52,205,653	H510N	probably benign	Het
Chil5	T	C	3: 106,018,220	D157G	probably damaging	Het
Clcn1	T	C	6: 42,292,995	S251P	probably damaging	Het
Clstn3	A	T	6: 124,431,711	C881S	probably benign	Het
Cnot4	G	A	6: 35,080,141		probably benign	Het
Copg1	G	A	6: 87,895,923		probably benign	Het
Eftud2	A	G	11: 102,844,180	M631T	probably damaging	Het
Elavl3	A	G	9: 22,018,744	V288A	probably damaging	Het
Fancb	A	G	X: 164,996,108	T721A	probably damaging	Het
Fat2	A	G	11: 55,260,516	F3800S	probably damaging	Het
Fgd2	T	C	17: 29,365,601	V173A	possibly damaging	Het
Gabrr1	T	C	4: 33,158,184		probably benign	Het
Gata4	C	T	14: 63,200,533	G390S	possibly damaging	Het
Gm9396	C	A	3: 130,068,495		noncoding transcript	Het
Grid2	T	C	6: 63,503,399	S66P	probably damaging	Het
Kmt2c	A	T	5: 25,299,479	D3610E	probably benign	Het
Lactb2	A	T	1: 13,660,449	M1K	probably null	Het
Ldhb	T	C	6: 142,501,447	D47G	probably damaging	Het
Map3k11	A	T	19: 5,690,247	M1L	probably benign	Het
Mecom	C	T	3: 29,980,912	R205H	probably damaging	Het
Mob1b	A	G	5: 88,749,620	D129G	probably benign	Het
Nbea	A	G	3: 55,681,010	V2436A	possibly damaging	Het
Neb	T	C	2: 52,325,785	N170S	probably damaging	Het
Nedd4l	G	A	18: 65,212,860	A848T	probably damaging	Het
Nr5a1	G	A	2: 38,707,940	R282*	probably null	Het
Olfr1189	A	G	2: 88,591,941	T46A	probably damaging	Het
Olfr1224-ps1	C	T	2: 89,157,059	G39R	probably damaging	Het
Olfr1317	T	C	2: 112,142,127	F61L	possibly damaging	Het
Olfr1426	A	G	19: 12,088,057	V245A	possibly damaging	Het
Olfr589	T	C	7: 103,155,090	Y219C	probably damaging	Het
Pcdhb19	T	A	18: 37,497,479	L109*	probably null	Het
Plcg2	A	G	8: 117,612,978	M1043V	probably benign	Het
Podxl2	T	C	6: 88,842,918	D554G	probably damaging	Het
Ppp3ca	A	G	3: 136,881,512	T252A	probably benign	Het
Pramel6	A	G	2: 87,509,225	H111R	probably damaging	Het
Prr19	A	G	7: 25,303,267	E130G	probably damaging	Het
Rab44	C	T	17: 29,138,067	A57V	probably benign	Het
Rhbdl3	T	C	11: 80,319,705	F95L	probably damaging	Het
Sdk1	G	T	5: 142,006,616		probably benign	Het
Tas2r122	T	A	6: 132,711,560	K123N	probably damaging	Het
Tbpl2	C	T	2: 24,087,139	R289Q	probably benign	Het
Trpm2	A	G	10: 77,932,302	F788L	probably benign	Het
Ttn	G	A	2: 76,730,284	L29258F	probably damaging	Het
Ttn	G	T	2: 76,761,165	F19307L	possibly damaging	Het
Vmn2r23	T	C	6: 123,713,170	I335T	possibly damaging	Het

Other mutations in Hdac9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01317:Hdac9	APN	12	34429489	splice site	probably benign
IGL01484:Hdac9	APN	12	34437165	missense	probably damaging	1.00
IGL02010:Hdac9	APN	12	34431945	missense	probably damaging	1.00
IGL02059:Hdac9	APN	12	34431968	missense	probably damaging	0.97
IGL02276:Hdac9	APN	12	34431926	missense	probably damaging	1.00
IGL02797:Hdac9	APN	12	34393274	splice site	probably benign
IGL03202:Hdac9	APN	12	34373951	missense	probably damaging	1.00
PIT4468001:Hdac9	UTSW	12	34095934	missense	unknown
R0304:Hdac9	UTSW	12	34374111	missense	probably damaging	1.00
R0432:Hdac9	UTSW	12	34437222	missense	probably damaging	1.00
R0659:Hdac9	UTSW	12	34437222	missense	probably damaging	1.00
R1826:Hdac9	UTSW	12	34429492	splice site	probably benign
R1879:Hdac9	UTSW	12	34390333	missense	probably damaging	0.98
R1942:Hdac9	UTSW	12	34429545	missense	probably damaging	1.00
R2113:Hdac9	UTSW	12	34389332	missense	probably damaging	1.00
R2151:Hdac9	UTSW	12	34390256	missense	probably damaging	1.00
R2216:Hdac9	UTSW	12	34429517	missense	probably damaging	1.00
R2224:Hdac9	UTSW	12	34407802	missense	probably benign	0.09
R2225:Hdac9	UTSW	12	34407802	missense	probably benign	0.09
R2227:Hdac9	UTSW	12	34407802	missense	probably benign	0.09
R4441:Hdac9	UTSW	12	34389376	missense	probably damaging	1.00
R4674:Hdac9	UTSW	12	34373960	missense	possibly damaging	0.96
R4694:Hdac9	UTSW	12	34437247	missense	probably damaging	1.00
R5033:Hdac9	UTSW	12	34373907	missense	probably benign
R5229:Hdac9	UTSW	12	34437164	missense	probably damaging	1.00
R5353:Hdac9	UTSW	12	34393393	nonsense	probably null
R5384:Hdac9	UTSW	12	34429558	missense	probably damaging	1.00
R5958:Hdac9	UTSW	12	34373883	missense	probably damaging	0.97
R6129:Hdac9	UTSW	12	34287475	missense	probably damaging	1.00
R6157:Hdac9	UTSW	12	34389429	missense	probably damaging	1.00
R6248:Hdac9	UTSW	12	34528294	missense	possibly damaging	0.79
R6333:Hdac9	UTSW	12	34052324	missense	probably damaging	0.98
R6474:Hdac9	UTSW	12	34431991	critical splice acceptor site	probably null
R6589:Hdac9	UTSW	12	34215029	missense	probably damaging	1.00
R6737:Hdac9	UTSW	12	34215452	missense	probably damaging	1.00
R6767:Hdac9	UTSW	12	34287529	missense	probably damaging	1.00
R6837:Hdac9	UTSW	12	34287464	missense	probably benign	0.12
R6857:Hdac9	UTSW	12	34393363	missense	probably benign	0.37
R7069:Hdac9	UTSW	12	34429549	missense	possibly damaging	0.92
R7237:Hdac9	UTSW	12	34374140	critical splice acceptor site	probably null
R7768:Hdac9	UTSW	12	34390240	missense	possibly damaging	0.81
Z1088:Hdac9	UTSW	12	34407789	missense	probably damaging	1.00
Z1176:Hdac9	UTSW	12	34373987	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTGCCTTGTCAAATTCTCG -3'
(R):5'- GATGGGCAGAACACAATTCACC -3'

Sequencing Primer
(F):5'- AAATTCTCGTGCTGCTTCTGAAAC -3'
(R):5'- ATGAAGCAGAGATTATACCCATTTC -3'

Posted On

2015-04-02