Incidental Mutation 'R3500:Gata4'
ID273777
Institutional Source Beutler Lab
Gene Symbol Gata4
Ensembl Gene ENSMUSG00000021944
Gene NameGATA binding protein 4
SynonymsGata-4
MMRRC Submission 040663-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3500 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location63198922-63271692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63200533 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 390 (G390S)
Ref Sequence ENSEMBL: ENSMUSP00000113891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067417] [ENSMUST00000118022] [ENSMUST00000121312]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067417
AA Change: G391S

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000066927
Gene: ENSMUSG00000021944
AA Change: G391S

DomainStartEndE-ValueType
Pfam:GATA-N 1 204 2.2e-54 PFAM
ZnF_GATA 211 261 4.36e-18 SMART
ZnF_GATA 265 315 1.02e-23 SMART
low complexity region 342 360 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118022
AA Change: G390S

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113891
Gene: ENSMUSG00000021944
AA Change: G390S

DomainStartEndE-ValueType
Pfam:GATA-N 1 207 7.8e-54 PFAM
ZnF_GATA 210 260 4.36e-18 SMART
ZnF_GATA 264 314 1.02e-23 SMART
low complexity region 341 359 N/A INTRINSIC
low complexity region 372 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121312
AA Change: G185S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113451
Gene: ENSMUSG00000021944
AA Change: G185S

DomainStartEndE-ValueType
ZnF_GATA 5 55 4.36e-18 SMART
ZnF_GATA 59 109 1.02e-23 SMART
low complexity region 136 154 N/A INTRINSIC
low complexity region 167 184 N/A INTRINSIC
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GATA family of zinc-finger transcription factors. Members of this family recognize the GATA motif which is present in the promoters of many genes. This protein is thought to regulate genes involved in embryogenesis and in myocardial differentiation and function, and is necessary for normal testicular development. Mutations in this gene have been associated with cardiac septal defects. Additionally, alterations in gene expression have been associated with several cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in ventral morphogenesis, lack a primitive heart tube and foregut, develop partially outside the yolk sac, and die by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Copg1 G A 6: 87,895,923 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R205H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Gata4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Gata4 APN 14 63200463 missense possibly damaging 0.53
IGL02481:Gata4 APN 14 63200461 missense probably benign 0.01
IGL02483:Gata4 APN 14 63200461 missense probably benign 0.01
IGL02643:Gata4 APN 14 63204755 missense possibly damaging 0.85
R0034:Gata4 UTSW 14 63201484 missense probably benign 0.00
R0043:Gata4 UTSW 14 63203301 splice site probably benign
R1131:Gata4 UTSW 14 63204740 missense possibly damaging 0.71
R1880:Gata4 UTSW 14 63204695 missense probably damaging 1.00
R3949:Gata4 UTSW 14 63240697 missense possibly damaging 0.95
R4893:Gata4 UTSW 14 63201596 missense probably benign 0.01
R4976:Gata4 UTSW 14 63203689 missense probably damaging 1.00
R5152:Gata4 UTSW 14 63241121 missense probably damaging 1.00
R5198:Gata4 UTSW 14 63200451 missense probably benign 0.09
R5237:Gata4 UTSW 14 63240626 missense probably benign 0.28
R5291:Gata4 UTSW 14 63240599 missense probably damaging 0.98
R5358:Gata4 UTSW 14 63240626 missense probably benign 0.28
R5693:Gata4 UTSW 14 63241145 missense probably damaging 1.00
R7143:Gata4 UTSW 14 63204617 missense probably damaging 1.00
R7299:Gata4 UTSW 14 63203742 missense probably damaging 1.00
R7729:Gata4 UTSW 14 63240737 missense probably benign 0.00
R7849:Gata4 UTSW 14 63204725 missense possibly damaging 0.92
R7932:Gata4 UTSW 14 63204725 missense possibly damaging 0.92
Z1177:Gata4 UTSW 14 63200382 missense probably damaging 0.99
Z1177:Gata4 UTSW 14 63241265 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTTGTTCCCAGACAAAGGGG -3'
(R):5'- TCAGAAGCCAACGTGGAAGC -3'

Sequencing Primer
(F):5'- ACGTCCCAAGTCCGAGCAG -3'
(R):5'- GTGGAAGCACACAGACCCTC -3'
Posted On2015-04-02