Incidental Mutation 'R3500:Olfr1426'
ID273785
Institutional Source Beutler Lab
Gene Symbol Olfr1426
Ensembl Gene ENSMUSG00000044994
Gene Nameolfactory receptor 1426
SynonymsGA_x6K02T2RE5P-2447610-2446675, MOR239-1
MMRRC Submission 040663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3500 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12086746-12092013 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12088057 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 245 (V245A)
Ref Sequence ENSEMBL: ENSMUSP00000151988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112952] [ENSMUST00000208703] [ENSMUST00000217952] [ENSMUST00000219005] [ENSMUST00000219155] [ENSMUST00000219996] [ENSMUST00000220005]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112952
AA Change: V245A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108575
Gene: ENSMUSG00000044994
AA Change: V245A

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 2.1e-49 PFAM
Pfam:7tm_1 39 300 1.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208703
AA Change: V245A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217952
AA Change: V245A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219005
AA Change: V245A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219155
AA Change: V245A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219996
AA Change: V245A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220005
AA Change: V245A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1387 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Copg1 G A 6: 87,895,923 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R205H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Olfr1426
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Olfr1426 APN 19 12087993 missense probably benign 0.28
IGL01549:Olfr1426 APN 19 12087965 missense probably benign 0.20
IGL02479:Olfr1426 APN 19 12087905 missense probably benign 0.01
IGL03065:Olfr1426 APN 19 12088611 missense possibly damaging 0.91
IGL03092:Olfr1426 APN 19 12087866 nonsense probably null
IGL03046:Olfr1426 UTSW 19 12088027 missense probably damaging 0.98
R0734:Olfr1426 UTSW 19 12088119 missense probably benign 0.12
R1190:Olfr1426 UTSW 19 12088687 missense possibly damaging 0.82
R1990:Olfr1426 UTSW 19 12088256 missense probably damaging 0.98
R2331:Olfr1426 UTSW 19 12088158 missense probably benign 0.00
R3768:Olfr1426 UTSW 19 12087940 missense probably damaging 1.00
R3825:Olfr1426 UTSW 19 12088027 missense probably damaging 0.98
R4589:Olfr1426 UTSW 19 12087941 missense possibly damaging 0.61
R5175:Olfr1426 UTSW 19 12088562 missense probably damaging 1.00
R6436:Olfr1426 UTSW 19 12087935 missense probably benign 0.24
R6729:Olfr1426 UTSW 19 12088496 missense probably benign 0.04
R6965:Olfr1426 UTSW 19 12088756 missense possibly damaging 0.95
R7099:Olfr1426 UTSW 19 12088166 missense possibly damaging 0.78
R7393:Olfr1426 UTSW 19 12088628 missense probably benign 0.13
R7582:Olfr1426 UTSW 19 12088006 missense probably benign 0.01
R8000:Olfr1426 UTSW 19 12087994 missense probably damaging 0.98
RF011:Olfr1426 UTSW 19 12088247 missense probably benign 0.09
Z1177:Olfr1426 UTSW 19 12087944 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGTTGTGACAGGGTCGAGC -3'
(R):5'- GCCTGCACAGACATCTTTGTTC -3'

Sequencing Primer
(F):5'- GACAGGGTCGAGCTATTGC -3'
(R):5'- GCACAGACATCTTTGTTCTTGAG -3'
Posted On2015-04-02