Incidental Mutation 'R3827:Cntnap5a'
ID273789
Institutional Source Beutler Lab
Gene Symbol Cntnap5a
Ensembl Gene ENSMUSG00000070695
Gene Namecontactin associated protein-like 5A
SynonymsCaspr5-1
MMRRC Submission 040775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R3827 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location115684756-116587323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116117679 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 342 (D342N)
Ref Sequence ENSEMBL: ENSMUSP00000035732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043725]
Predicted Effect probably benign
Transcript: ENSMUST00000043725
AA Change: D342N

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000035732
Gene: ENSMUSG00000070695
AA Change: D342N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 33 174 1.63e-13 SMART
LamG 201 338 1.4e-26 SMART
LamG 388 522 1.5e-26 SMART
EGF 550 584 2.16e-1 SMART
Blast:FBG 587 772 2e-81 BLAST
LamG 812 939 1.54e-28 SMART
EGF 960 996 2.28e0 SMART
LamG 1037 1173 4.73e-15 SMART
transmembrane domain 1241 1263 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,290,097 N878S probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dpp10 G A 1: 123,411,790 T336I possibly damaging Het
Ehmt2 T C 17: 34,906,765 S625P possibly damaging Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gab2 T A 7: 97,223,741 I117N probably damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gper1 T C 5: 139,427,000 S367P probably benign Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
H2-Q6 A T 17: 35,425,679 N148I probably damaging Het
Kif21b T C 1: 136,162,994 probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr596 T A 7: 103,309,802 I27N probably benign Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Paip1 T A 13: 119,430,232 M1K probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Skint6 G T 4: 112,937,437 L712I probably benign Het
Slc35a4 C A 18: 36,682,988 N290K probably damaging Het
Slco1a5 T A 6: 142,253,249 D230V probably damaging Het
Sox21 C T 14: 118,235,458 E60K possibly damaging Het
Steap3 G A 1: 120,227,730 R500C probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Sulf1 G A 1: 12,817,432 V277I probably benign Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Syne2 A G 12: 75,987,031 R3685G probably benign Het
Tmem203 T A 2: 25,256,006 W113R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Vmn2r102 T A 17: 19,694,525 V784E probably damaging Het
Wrn T C 8: 33,324,520 T56A probably benign Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Other mutations in Cntnap5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Cntnap5a APN 1 116117677 missense possibly damaging 0.48
IGL00929:Cntnap5a APN 1 116060274 splice site probably null
IGL00959:Cntnap5a APN 1 116184327 missense probably benign 0.00
IGL01721:Cntnap5a APN 1 116157637 missense probably benign
IGL02009:Cntnap5a APN 1 116157494 missense probably benign 0.15
IGL02111:Cntnap5a APN 1 116089352 missense probably benign 0.00
IGL02198:Cntnap5a APN 1 116580532 missense probably benign
IGL02751:Cntnap5a APN 1 116184457 critical splice donor site probably null
IGL02752:Cntnap5a APN 1 116580531 missense probably benign 0.00
IGL02989:Cntnap5a APN 1 116412083 splice site probably benign
IGL03195:Cntnap5a APN 1 116157448 missense probably benign 0.00
PIT4142001:Cntnap5a UTSW 1 115684956 start gained probably benign
R0294:Cntnap5a UTSW 1 115915316 missense probably benign
R0377:Cntnap5a UTSW 1 116292529 missense probably benign 0.04
R0597:Cntnap5a UTSW 1 116184461 splice site probably benign
R0616:Cntnap5a UTSW 1 116580549 missense possibly damaging 0.80
R0725:Cntnap5a UTSW 1 116292476 missense probably benign 0.25
R0842:Cntnap5a UTSW 1 116442223 missense probably damaging 0.96
R1103:Cntnap5a UTSW 1 116580669 missense possibly damaging 0.81
R1265:Cntnap5a UTSW 1 116428518 missense possibly damaging 0.49
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1474:Cntnap5a UTSW 1 116442373 nonsense probably null
R1476:Cntnap5a UTSW 1 115901020 missense probably damaging 1.00
R1481:Cntnap5a UTSW 1 116117663 missense probably damaging 1.00
R1512:Cntnap5a UTSW 1 115900950 missense probably benign
R1526:Cntnap5a UTSW 1 116428477 missense probably benign
R1589:Cntnap5a UTSW 1 116060200 missense possibly damaging 0.77
R1603:Cntnap5a UTSW 1 116412101 missense possibly damaging 0.80
R1728:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1729:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1730:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1739:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1762:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1783:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1785:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1816:Cntnap5a UTSW 1 116428888 missense probably benign 0.19
R1872:Cntnap5a UTSW 1 116089210 missense probably benign 0.02
R2095:Cntnap5a UTSW 1 116442260 missense probably damaging 1.00
R2113:Cntnap5a UTSW 1 116188365 missense probably damaging 0.98
R2144:Cntnap5a UTSW 1 116101710 missense probably benign 0.14
R2171:Cntnap5a UTSW 1 116188402 missense possibly damaging 0.95
R2219:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2220:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2571:Cntnap5a UTSW 1 116184362 missense probably damaging 1.00
R3019:Cntnap5a UTSW 1 116101569 missense probably benign
R3870:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R3871:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R4041:Cntnap5a UTSW 1 116184399 missense probably benign 0.00
R4080:Cntnap5a UTSW 1 116101574 missense probably benign 0.01
R4260:Cntnap5a UTSW 1 116446595 missense probably benign 0.31
R4685:Cntnap5a UTSW 1 116446680 missense possibly damaging 0.69
R4781:Cntnap5a UTSW 1 116412201 missense possibly damaging 0.88
R4785:Cntnap5a UTSW 1 116101565 missense probably benign 0.00
R5057:Cntnap5a UTSW 1 115685213 missense probably benign 0.10
R5059:Cntnap5a UTSW 1 116428494 missense probably benign 0.44
R5101:Cntnap5a UTSW 1 116442296 missense probably benign 0.00
R5302:Cntnap5a UTSW 1 116157570 missense probably benign 0.15
R5451:Cntnap5a UTSW 1 115685143 missense probably benign
R5473:Cntnap5a UTSW 1 116089256 missense probably benign 0.12
R5886:Cntnap5a UTSW 1 116571672 critical splice donor site probably null
R6311:Cntnap5a UTSW 1 116412106 nonsense probably null
R6464:Cntnap5a UTSW 1 116184408 missense probably benign
R6497:Cntnap5a UTSW 1 116577897 missense probably damaging 1.00
R6781:Cntnap5a UTSW 1 116292397 missense probably benign 0.05
R7137:Cntnap5a UTSW 1 116089376 missense probably damaging 1.00
Z1088:Cntnap5a UTSW 1 116060251 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGCTCACAACTACAACTACGT -3'
(R):5'- CAGCATGTAGTACAACGAGAATTGA -3'

Sequencing Primer
(F):5'- CAACTACGTCTAGAGAAATGTACTTC -3'
(R):5'- TTCATACATGCTAGGCAGGC -3'
Posted On2015-04-02