Incidental Mutation 'R3827:Olfr596'
ID273805
Institutional Source Beutler Lab
Gene Symbol Olfr596
Ensembl Gene ENSMUSG00000073953
Gene Nameolfactory receptor 596
SynonymsOlfr596-ps1, Gm15117, ENSMUSG00000073953, GA_x6K02T2PBJ9-6019769-6019943
MMRRC Submission 040775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3827 (G1)
Quality Score105
Status Not validated
Chromosome7
Chromosomal Location103305648-103312782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103309802 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 27 (I27N)
Ref Sequence ENSEMBL: ENSMUSP00000149187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104880] [ENSMUST00000214577]
Predicted Effect probably benign
Transcript: ENSMUST00000104880
AA Change: I27N

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100475
Gene: ENSMUSG00000073953
AA Change: I27N

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.5e-121 PFAM
Pfam:7TM_GPCR_Srsx 37 210 5.1e-11 PFAM
Pfam:7tm_1 43 293 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214577
AA Change: I27N

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,290,097 N878S probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Cntnap5a G A 1: 116,117,679 D342N probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dpp10 G A 1: 123,411,790 T336I possibly damaging Het
Ehmt2 T C 17: 34,906,765 S625P possibly damaging Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gab2 T A 7: 97,223,741 I117N probably damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gper1 T C 5: 139,427,000 S367P probably benign Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
H2-Q6 A T 17: 35,425,679 N148I probably damaging Het
Kif21b T C 1: 136,162,994 probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Paip1 T A 13: 119,430,232 M1K probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Skint6 G T 4: 112,937,437 L712I probably benign Het
Slc35a4 C A 18: 36,682,988 N290K probably damaging Het
Slco1a5 T A 6: 142,253,249 D230V probably damaging Het
Sox21 C T 14: 118,235,458 E60K possibly damaging Het
Steap3 G A 1: 120,227,730 R500C probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Sulf1 G A 1: 12,817,432 V277I probably benign Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Syne2 A G 12: 75,987,031 R3685G probably benign Het
Tmem203 T A 2: 25,256,006 W113R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Vmn2r102 T A 17: 19,694,525 V784E probably damaging Het
Wrn T C 8: 33,324,520 T56A probably benign Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Other mutations in Olfr596
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Olfr596 APN 7 103309807 missense probably benign 0.03
IGL01917:Olfr596 APN 7 103310357 nonsense probably null
G1patch:Olfr596 UTSW 7 103310354 missense probably damaging 1.00
R0601:Olfr596 UTSW 7 103310164 missense probably damaging 1.00
R0908:Olfr596 UTSW 7 103310573 missense possibly damaging 0.56
R1762:Olfr596 UTSW 7 103310221 missense probably damaging 1.00
R1772:Olfr596 UTSW 7 103310242 missense possibly damaging 0.94
R1806:Olfr596 UTSW 7 103310225 missense probably damaging 1.00
R2035:Olfr596 UTSW 7 103310256 missense probably damaging 1.00
R2365:Olfr596 UTSW 7 103310173 missense probably benign 0.00
R4241:Olfr596 UTSW 7 103310661 makesense probably null
R4619:Olfr596 UTSW 7 103309958 missense probably benign 0.04
R4620:Olfr596 UTSW 7 103309958 missense probably benign 0.04
R6279:Olfr596 UTSW 7 103310429 missense probably benign
R6300:Olfr596 UTSW 7 103310429 missense probably benign
R6505:Olfr596 UTSW 7 103309793 missense probably benign 0.00
R6725:Olfr596 UTSW 7 103310354 missense probably damaging 1.00
R7175:Olfr596 UTSW 7 103309847 missense probably benign 0.22
R7708:Olfr596 UTSW 7 103310561 missense probably damaging 1.00
R8855:Olfr596 UTSW 7 103309961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGGGATTCATCTACAACTTTC -3'
(R):5'- TGGATGAGGCAGCCTTCAAAG -3'

Sequencing Primer
(F):5'- ATAGTCCTCCAGGAGTCT -3'
(R):5'- GATGAGGCAGCCTTCAAAGCTTATC -3'
Posted On2015-04-02