Incidental Mutation 'R3827:Rrm2'
ID273813
Institutional Source Beutler Lab
Gene Symbol Rrm2
Ensembl Gene ENSMUSG00000020649
Gene Nameribonucleotide reductase M2
SynonymsR2
MMRRC Submission 040775-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3827 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location24708241-24714146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24708599 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 47 (A47S)
Ref Sequence ENSEMBL: ENSMUSP00000020980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020980] [ENSMUST00000153058] [ENSMUST00000154588]
PDB Structure
SMALL SUBUNIT C-TERMINAL INHIBITORY PEPTIDE OF MOUSE RIBONUCLEOTIDE REDUCTASE AS BOUND TO THE LARGE SUBUNIT, NMR, 26 STRUCTURES [SOLUTION NMR]
COBALT SUBSTITUTION OF MOUSE R2 RIBONUCLEOTIDE REDUCTASE TO MODEL THE REACTIVE DIFERROUS STATE [X-RAY DIFFRACTION]
COBALT SUBSTITUTION OF MOUSE R2 RIBONUCLEOTIDE REDUCTASE TO MODEL THE REACTIVE DIFERROUS STATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE RIBONUCLEOTIDE REDUCTASE SUBUNIT R2 UNDER OXIDIZING CONDITIONS. A FULLY OCCUPIED DINUCLEAR IRON CLUSTER. [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE RIBONUCLEOTIDE REDUCTASE SUBUNIT R2 UNDER REDUCING CONDITIONS. A FULLY OCCUPIED DINUCLEAR IRON CLUSTER AND BOUND ACETATE. [X-RAY DIFFRACTION]
PROTEIN R2 OF RIBONUCLEOTIDE REDUCTASE FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020980
AA Change: A47S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020980
Gene: ENSMUSG00000020649
AA Change: A47S

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 80 347 1.6e-124 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147789
Predicted Effect probably benign
Transcript: ENSMUST00000153058
SMART Domains Protein: ENSMUSP00000120893
Gene: ENSMUSG00000020649

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Ribonuc_red_sm 40 225 2.6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154588
SMART Domains Protein: ENSMUSP00000119502
Gene: ENSMUSG00000020649

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 1 181 2.7e-88 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two non-identical subunits for ribonucleotide reductase. This reductase catalyzes the formation of deoxyribonucleotides from ribonucleotides. Synthesis of the encoded protein (M2) is regulated in a cell-cycle dependent fashion. Transcription from this gene can initiate from alternative promoters, which results in two isoforms that differ in the lengths of their N-termini. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,290,097 N878S probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Cntnap5a G A 1: 116,117,679 D342N probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dpp10 G A 1: 123,411,790 T336I possibly damaging Het
Ehmt2 T C 17: 34,906,765 S625P possibly damaging Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gab2 T A 7: 97,223,741 I117N probably damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gper1 T C 5: 139,427,000 S367P probably benign Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
H2-Q6 A T 17: 35,425,679 N148I probably damaging Het
Kif21b T C 1: 136,162,994 probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr596 T A 7: 103,309,802 I27N probably benign Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Paip1 T A 13: 119,430,232 M1K probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Skint6 G T 4: 112,937,437 L712I probably benign Het
Slc35a4 C A 18: 36,682,988 N290K probably damaging Het
Slco1a5 T A 6: 142,253,249 D230V probably damaging Het
Sox21 C T 14: 118,235,458 E60K possibly damaging Het
Steap3 G A 1: 120,227,730 R500C probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Sulf1 G A 1: 12,817,432 V277I probably benign Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Syne2 A G 12: 75,987,031 R3685G probably benign Het
Tmem203 T A 2: 25,256,006 W113R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Vmn2r102 T A 17: 19,694,525 V784E probably damaging Het
Wrn T C 8: 33,324,520 T56A probably benign Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Other mutations in Rrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Rrm2 APN 12 24711439 splice site probably benign
IGL02361:Rrm2 APN 12 24711439 splice site probably benign
IGL02957:Rrm2 APN 12 24708441 missense probably damaging 0.99
R1804:Rrm2 UTSW 12 24708612 missense probably benign 0.42
R1854:Rrm2 UTSW 12 24713152 missense probably damaging 1.00
R3826:Rrm2 UTSW 12 24708599 missense probably benign
R3828:Rrm2 UTSW 12 24708599 missense probably benign
R3830:Rrm2 UTSW 12 24708599 missense probably benign
R3851:Rrm2 UTSW 12 24708599 missense probably benign
R3938:Rrm2 UTSW 12 24709432 missense probably damaging 1.00
R4042:Rrm2 UTSW 12 24711451 missense probably benign 0.00
R4192:Rrm2 UTSW 12 24708378 missense probably benign 0.04
R5274:Rrm2 UTSW 12 24710407 nonsense probably null
R8375:Rrm2 UTSW 12 24712752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCTGACAAGGAGAACAC -3'
(R):5'- ATCTCGTGTGCTTAGCTGTCAC -3'

Sequencing Primer
(F):5'- AACACGGTGAGGGCGGC -3'
(R):5'- GACCCGAGTAGGACATTCTG -3'
Posted On2015-04-02