Mutagenetix > Incidental Mutations

Incidental Mutation 'R3827:Adcy5'

273820

Institutional Source

Beutler Lab

Gene Symbol

Adcy5

Ensembl Gene

ENSMUSG00000022840

Gene Name

adenylate cyclase 5

Synonyms

AC5

MMRRC Submission

040775-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.189) question?

Stock #

R3827 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35154877-35305738 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35290097 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 878 (N878S)

Ref Sequence

ENSEMBL: ENSMUSP00000110563 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114913]

Predicted Effect

probably benign
Transcript: ENSMUST00000114913
AA Change: N878S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: N878S

Domain	Start	End	E-Value	Type
low complexity region	47	59	N/A	INTRINSIC
low complexity region	75	89	N/A	INTRINSIC
low complexity region	107	150	N/A	INTRINSIC
low complexity region	158	175	N/A	INTRINSIC
low complexity region	181	208	N/A	INTRINSIC
low complexity region	243	258	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	305	320	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
CYCc	424	623	2.62e-69	SMART
Pfam:DUF1053	669	762	1.8e-30	PFAM
transmembrane domain	794	816	N/A	INTRINSIC
transmembrane domain	837	856	N/A	INTRINSIC
transmembrane domain	910	932	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	985	1004	N/A	INTRINSIC
CYCc	1032	1240	2.98e-50	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231960

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bach2	T	A	4: 32,563,150	L539H	probably damaging	Het
Cntnap5a	G	A	1: 116,117,679	D342N	probably benign	Het
Cx3cl1	A	T	8: 94,777,306		probably benign	Het
Dpp10	G	A	1: 123,411,790	T336I	possibly damaging	Het
Ehmt2	T	C	17: 34,906,765	S625P	possibly damaging	Het
Fam234a	T	C	17: 26,218,189	E172G	probably benign	Het
Ffar2	A	T	7: 30,820,085	I10N	possibly damaging	Het
Gab2	T	A	7: 97,223,741	I117N	probably damaging	Het
Gm17521	C	A	X: 123,029,225	G149C	unknown	Het
Gper1	T	C	5: 139,427,000	S367P	probably benign	Het
Grpel1	T	A	5: 36,469,483	N36K	probably benign	Het
H2-Q6	A	T	17: 35,425,679	N148I	probably damaging	Het
Kif21b	T	C	1: 136,162,994		probably null	Het
Myg1	G	C	15: 102,337,736	G349R	probably damaging	Het
Olfr596	T	A	7: 103,309,802	I27N	probably benign	Het
Olfr99	T	A	17: 37,280,249	Y57F	probably damaging	Het
Paip1	T	A	13: 119,430,232	M1K	probably null	Het
Rgs12	G	A	5: 34,966,015	V381M	possibly damaging	Het
Rrm2	G	T	12: 24,708,599	A47S	probably benign	Het
Rsph6a	T	C	7: 19,057,614	L236P	probably damaging	Het
Rtkn2	A	T	10: 67,997,626		probably null	Het
Sh3bp1	T	C	15: 78,904,497	S241P	possibly damaging	Het
Skint6	G	T	4: 112,937,437	L712I	probably benign	Het
Slc35a4	C	A	18: 36,682,988	N290K	probably damaging	Het
Slco1a5	T	A	6: 142,253,249	D230V	probably damaging	Het
Sox21	C	T	14: 118,235,458	E60K	possibly damaging	Het
Steap3	G	A	1: 120,227,730	R500C	probably damaging	Het
Stk11	T	C	10: 80,127,948		probably null	Het
Sulf1	G	A	1: 12,817,432	V277I	probably benign	Het
Svep1	A	G	4: 58,096,177	L1481P	probably damaging	Het
Syne2	A	G	12: 75,987,031	R3685G	probably benign	Het
Tmem203	T	A	2: 25,256,006	W113R	possibly damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Tspan18	T	C	2: 93,220,108	I57V	probably benign	Het
Vmn2r102	T	A	17: 19,694,525	V784E	probably damaging	Het
Wrn	T	C	8: 33,324,520	T56A	probably benign	Het
Zfhx4	A	T	3: 5,401,209	K2142N	probably damaging	Het

Other mutations in Adcy5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Adcy5	APN	16	35253213	missense	possibly damaging	0.49
IGL01583:Adcy5	APN	16	35283513	splice site	probably benign
IGL01608:Adcy5	APN	16	35272165	missense	probably damaging	1.00
IGL02097:Adcy5	APN	16	35272098	missense	probably damaging	1.00
IGL02122:Adcy5	APN	16	35283612	splice site	probably benign
IGL02532:Adcy5	APN	16	35272083	missense	possibly damaging	0.79
IGL02814:Adcy5	APN	16	35303649	missense	probably benign	0.08
IGL02877:Adcy5	APN	16	35298600	missense	probably damaging	1.00
IGL03026:Adcy5	APN	16	35157042	missense	probably benign	0.41
IGL03345:Adcy5	APN	16	35248814	missense	probably benign	0.05
H8562:Adcy5	UTSW	16	35267181	missense	probably damaging	1.00
H8786:Adcy5	UTSW	16	35267181	missense	probably damaging	1.00
R0050:Adcy5	UTSW	16	35304303	utr 3 prime	probably benign
R0091:Adcy5	UTSW	16	35270998	critical splice donor site	probably null
R0112:Adcy5	UTSW	16	35156178	missense	possibly damaging	0.85
R0398:Adcy5	UTSW	16	35269068	missense	probably damaging	1.00
R0457:Adcy5	UTSW	16	35274545	missense	probably benign	0.07
R0554:Adcy5	UTSW	16	35294017	missense	probably benign	0.26
R0698:Adcy5	UTSW	16	35290082	missense	possibly damaging	0.78
R0761:Adcy5	UTSW	16	35270825	splice site	probably benign
R0865:Adcy5	UTSW	16	35274471	missense	probably damaging	0.96
R0927:Adcy5	UTSW	16	35156243	missense	probably benign	0.32
R0945:Adcy5	UTSW	16	35290111	missense	probably benign
R1534:Adcy5	UTSW	16	35253259	missense	possibly damaging	0.92
R1565:Adcy5	UTSW	16	35268957	missense	probably damaging	1.00
R1721:Adcy5	UTSW	16	35298424	missense	probably damaging	1.00
R1839:Adcy5	UTSW	16	35248940	missense	probably damaging	1.00
R2047:Adcy5	UTSW	16	35290108	missense	possibly damaging	0.78
R3052:Adcy5	UTSW	16	35303716	missense	probably damaging	1.00
R3053:Adcy5	UTSW	16	35303716	missense	probably damaging	1.00
R4398:Adcy5	UTSW	16	35268993	missense	probably damaging	1.00
R4700:Adcy5	UTSW	16	35279216	missense	possibly damaging	0.49
R4965:Adcy5	UTSW	16	35278502	missense	possibly damaging	0.82
R5229:Adcy5	UTSW	16	35269070	missense	probably damaging	0.99
R5456:Adcy5	UTSW	16	35298522	missense	probably damaging	1.00
R5586:Adcy5	UTSW	16	35157116	missense	probably damaging	0.99
R5757:Adcy5	UTSW	16	35272081	missense	probably damaging	1.00
R5959:Adcy5	UTSW	16	35298410	missense	probably damaging	1.00
R6011:Adcy5	UTSW	16	35157228	missense	probably benign	0.05
R6277:Adcy5	UTSW	16	35289526	missense	probably benign	0.02
R6296:Adcy5	UTSW	16	35303710	missense	probably damaging	1.00
R6379:Adcy5	UTSW	16	35293999	missense	probably benign	0.13
R6431:Adcy5	UTSW	16	35279237	missense	probably damaging	1.00
R6685:Adcy5	UTSW	16	35279216	missense	possibly damaging	0.49
R6728:Adcy5	UTSW	16	35157165	missense	possibly damaging	0.88
R6755:Adcy5	UTSW	16	35303634	missense	possibly damaging	0.95
R6887:Adcy5	UTSW	16	35298590	missense	possibly damaging	0.74
R7029:Adcy5	UTSW	16	35299648	missense	probably null	0.91
R7047:Adcy5	UTSW	16	35267215	missense	probably damaging	1.00
R7050:Adcy5	UTSW	16	35303700	missense	possibly damaging	0.88
R7102:Adcy5	UTSW	16	35299625	missense	probably damaging	1.00
R7150:Adcy5	UTSW	16	35298534	missense	probably damaging	1.00
R7242:Adcy5	UTSW	16	35156835	missense	probably damaging	1.00
R7387:Adcy5	UTSW	16	35272090	missense	probably damaging	1.00
R7654:Adcy5	UTSW	16	35270947	missense	probably damaging	1.00
R7718:Adcy5	UTSW	16	35280415	missense	probably benign	0.42
R7834:Adcy5	UTSW	16	35157200	missense	probably benign	0.03
R8172:Adcy5	UTSW	16	35157057	missense	probably damaging	0.96
R8772:Adcy5	UTSW	16	35299588	missense	not run
V7732:Adcy5	UTSW	16	35283541	missense	probably benign	0.00
X0022:Adcy5	UTSW	16	35299456	missense	probably damaging	0.99
Z1176:Adcy5	UTSW	16	35156321	missense	unknown
Z1176:Adcy5	UTSW	16	35290185	missense	probably benign	0.03
Z1176:Adcy5	UTSW	16	35291544	missense	not run
Z1177:Adcy5	UTSW	16	35291544	missense	not run

Predicted Primers

PCR Primer
(F):5'- TACAGTGCTGCTCCTGAGAC -3'
(R):5'- CAGCTATGTTGTGAACACCGTC -3'

Sequencing Primer
(F):5'- AGACAGGGTGGGTCTGGTAC -3'
(R):5'- CACCGTCTTTGTAATAAGGAGGC -3'

Posted On

2015-04-02