Incidental Mutation 'R3828:Ino80d'
ID273832
Institutional Source Beutler Lab
Gene Symbol Ino80d
Ensembl Gene ENSMUSG00000040865
Gene NameINO80 complex subunit D
SynonymsA430093A21Rik
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location62958418-63114667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63062078 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 463 (M463K)
Ref Sequence ENSEMBL: ENSMUSP00000127378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097718] [ENSMUST00000133236] [ENSMUST00000137511] [ENSMUST00000153992] [ENSMUST00000165066] [ENSMUST00000172416]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097718
AA Change: M463K

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095325
Gene: ENSMUSG00000040865
AA Change: M463K

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 1.2e-22 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133236
AA Change: M463K

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123430
Gene: ENSMUSG00000040865
AA Change: M463K

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 337 401 4.3e-20 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137511
SMART Domains Protein: ENSMUSP00000119118
Gene: ENSMUSG00000040865

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 4.3e-23 PFAM
low complexity region 414 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153992
SMART Domains Protein: ENSMUSP00000115332
Gene: ENSMUSG00000040865

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 4.3e-23 PFAM
low complexity region 414 431 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165066
AA Change: M568K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130864
Gene: ENSMUSG00000040865
AA Change: M568K

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 18 79 5.9e-21 PFAM
low complexity region 196 206 N/A INTRINSIC
low complexity region 258 263 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
Pfam:zf-C3Hc3H 442 506 7e-21 PFAM
low complexity region 519 564 N/A INTRINSIC
low complexity region 640 654 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
low complexity region 811 827 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
low complexity region 995 1016 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172416
AA Change: M463K

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127378
Gene: ENSMUSG00000040865
AA Change: M463K

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 1.2e-22 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188100
Meta Mutation Damage Score 0.1162 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Ino80d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Ino80d APN 1 63093303 missense probably damaging 1.00
IGL01552:Ino80d APN 1 63057977 utr 3 prime probably benign
IGL01960:Ino80d APN 1 63058147 missense probably damaging 0.98
IGL02374:Ino80d APN 1 63086061 missense possibly damaging 0.63
IGL03201:Ino80d APN 1 63058308 missense probably damaging 1.00
IGL03248:Ino80d APN 1 63068182 critical splice donor site probably null
Creepy UTSW 1 63079047 missense possibly damaging 0.88
Friable UTSW 1 63062126 missense probably damaging 1.00
Herpes UTSW 1 63065834 missense probably damaging 1.00
PIT4696001:Ino80d UTSW 1 63085986 missense probably benign
R0153:Ino80d UTSW 1 63058318 missense probably damaging 0.97
R0371:Ino80d UTSW 1 63057956 utr 3 prime probably benign
R0416:Ino80d UTSW 1 63086276 missense possibly damaging 0.93
R1738:Ino80d UTSW 1 63093465 missense probably damaging 1.00
R2341:Ino80d UTSW 1 63065826 missense possibly damaging 0.75
R2351:Ino80d UTSW 1 63085835 missense probably benign 0.00
R2870:Ino80d UTSW 1 63061039 critical splice donor site probably null
R2870:Ino80d UTSW 1 63061039 critical splice donor site probably null
R3814:Ino80d UTSW 1 63074424 missense probably benign 0.05
R3947:Ino80d UTSW 1 63074503 missense probably benign 0.16
R3949:Ino80d UTSW 1 63074503 missense probably benign 0.16
R5180:Ino80d UTSW 1 63086329 start gained probably benign
R5301:Ino80d UTSW 1 63074419 missense probably benign
R5338:Ino80d UTSW 1 63058939 missense probably benign 0.34
R5634:Ino80d UTSW 1 63062283 intron probably benign
R5716:Ino80d UTSW 1 63058697 missense probably benign 0.01
R5841:Ino80d UTSW 1 63058840 missense probably damaging 1.00
R6219:Ino80d UTSW 1 63079047 missense possibly damaging 0.88
R6222:Ino80d UTSW 1 63058525 missense probably damaging 0.99
R6283:Ino80d UTSW 1 63062126 missense probably damaging 1.00
R6720:Ino80d UTSW 1 63058610 missense probably damaging 1.00
R6835:Ino80d UTSW 1 63074326 missense probably benign
R6897:Ino80d UTSW 1 63065834 missense probably damaging 1.00
R7162:Ino80d UTSW 1 63065735 missense probably damaging 1.00
R7403:Ino80d UTSW 1 63062219 missense possibly damaging 0.52
R7644:Ino80d UTSW 1 63058771 missense probably benign 0.18
R7816:Ino80d UTSW 1 63086397 missense probably damaging 1.00
R8054:Ino80d UTSW 1 63058678 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GTACATGCCACTGTTCAAAGGG -3'
(R):5'- GCGCACTAACATACCAGGAGTC -3'

Sequencing Primer
(F):5'- GCCACTGTTCAAAGGGTTTTAAGC -3'
(R):5'- TGGAGAAGGTTCTTAAAAGTGTTC -3'
Posted On2015-04-02