Incidental Mutation 'R3828:Syt14'
ID273833
Institutional Source Beutler Lab
Gene Symbol Syt14
Ensembl Gene ENSMUSG00000016200
Gene Namesynaptotagmin XIV
SynonymsB230320I09Rik
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location192891233-193035775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 192901775 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 444 (N444S)
Ref Sequence ENSEMBL: ENSMUSP00000142190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016344] [ENSMUST00000195354] [ENSMUST00000195530] [ENSMUST00000215093]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016344
AA Change: N444S

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000016344
Gene: ENSMUSG00000016200
AA Change: N444S

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
C2 276 378 1.41e0 SMART
C2 431 547 1.38e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195354
AA Change: N444S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142190
Gene: ENSMUSG00000016200
AA Change: N444S

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
C2 276 378 1.41e0 SMART
C2 431 547 1.38e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195530
SMART Domains Protein: ENSMUSP00000141563
Gene: ENSMUSG00000016200

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215093
AA Change: N727S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.0987 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: This gene encodes a member of the synaptotagmin family. The encoded protein may be involved in membrane trafficking. Disruption of a similar gene in human has been associated with autosomal recessive spinocerebellar ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Syt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Syt14 APN 1 192930484 missense possibly damaging 0.88
IGL01535:Syt14 APN 1 192986765 missense probably damaging 1.00
IGL01935:Syt14 APN 1 192933371 missense probably damaging 0.99
IGL02531:Syt14 APN 1 192901934 makesense probably null
IGL02716:Syt14 APN 1 192980535 missense possibly damaging 0.92
IGL03051:Syt14 APN 1 192933220 missense probably benign 0.19
IGL03268:Syt14 APN 1 192986834 missense probably benign 0.25
crumpled UTSW 1 192901869 missense possibly damaging 0.82
R0542:Syt14 UTSW 1 192930803 missense probably damaging 1.00
R0598:Syt14 UTSW 1 192897314 missense probably damaging 1.00
R1533:Syt14 UTSW 1 192930776 missense possibly damaging 0.94
R1675:Syt14 UTSW 1 192897482 missense probably damaging 1.00
R1907:Syt14 UTSW 1 192901835 missense probably damaging 1.00
R3032:Syt14 UTSW 1 192986751 missense possibly damaging 0.86
R3965:Syt14 UTSW 1 192901867 missense probably benign 0.04
R4646:Syt14 UTSW 1 192933325 missense probably damaging 1.00
R4730:Syt14 UTSW 1 192930786 missense probably damaging 1.00
R4909:Syt14 UTSW 1 192898859 missense probably damaging 1.00
R4970:Syt14 UTSW 1 192930977 intron probably benign
R5039:Syt14 UTSW 1 193026984 missense probably damaging 1.00
R5363:Syt14 UTSW 1 192930663 missense possibly damaging 0.94
R5593:Syt14 UTSW 1 192930923 missense probably damaging 1.00
R5980:Syt14 UTSW 1 192980408 missense possibly damaging 0.89
R6014:Syt14 UTSW 1 192930695 missense probably damaging 0.99
R6221:Syt14 UTSW 1 192930600 missense probably damaging 1.00
R6547:Syt14 UTSW 1 192901869 missense possibly damaging 0.82
R6804:Syt14 UTSW 1 192901853 missense probably damaging 1.00
R7038:Syt14 UTSW 1 192983658 intron probably benign
R7179:Syt14 UTSW 1 192933263 missense probably damaging 1.00
R7196:Syt14 UTSW 1 193035628 missense probably benign 0.01
R7311:Syt14 UTSW 1 192980550 missense probably benign
R7577:Syt14 UTSW 1 192983577 missense unknown
R7769:Syt14 UTSW 1 192984324 missense unknown
R7779:Syt14 UTSW 1 192984443 missense unknown
R8213:Syt14 UTSW 1 192986829 missense probably benign 0.00
Z1176:Syt14 UTSW 1 192933198 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCTGTAACTTCTTCTGGCATTAAAAG -3'
(R):5'- ATATTTGCTCTACAGGGCTGTG -3'

Sequencing Primer
(F):5'- ATAGGGATAATTTATTCTGCAGACAC -3'
(R):5'- TCTACAGGGCTGTGACTCTCAG -3'
Posted On2015-04-02